ID: 961819833

View in Genome Browser
Species Human (GRCh38)
Location 3:129570365-129570387
Sequence CACCCCAGGATGGCTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961819833_961819839 17 Left 961819833 3:129570365-129570387 CCAGTCAGAGCCATCCTGGGGTG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 961819839 3:129570405-129570427 GAGAGTGAGCTCCCCATCCCAGG 0: 1
1: 1
2: 10
3: 69
4: 326
961819833_961819837 -8 Left 961819833 3:129570365-129570387 CCAGTCAGAGCCATCCTGGGGTG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 961819837 3:129570380-129570402 CTGGGGTGGCACACGCTGCTTGG 0: 1
1: 0
2: 0
3: 12
4: 132
961819833_961819842 29 Left 961819833 3:129570365-129570387 CCAGTCAGAGCCATCCTGGGGTG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 961819842 3:129570417-129570439 CCCATCCCAGGAGACATGCAAGG 0: 1
1: 0
2: 3
3: 25
4: 243
961819833_961819838 -7 Left 961819833 3:129570365-129570387 CCAGTCAGAGCCATCCTGGGGTG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 961819838 3:129570381-129570403 TGGGGTGGCACACGCTGCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961819833 Original CRISPR CACCCCAGGATGGCTCTGAC TGG (reversed) Intronic
900285691 1:1899270-1899292 GACCCCAGGAGGACTCTGAAAGG + Intergenic
900483231 1:2909476-2909498 CACCCCAGGTGGACTCTGATGGG - Intergenic
902779285 1:18693957-18693979 CCCCTCAGGATGGCTTTGCCTGG - Intronic
902921179 1:19666634-19666656 CACCACAGGATAGCTCCGTCAGG + Intronic
904338041 1:29810558-29810580 CACCCCAAGAAGGCACTGGCCGG + Intergenic
905886679 1:41495576-41495598 CATCCCAGTATGGCCCTGCCCGG + Intergenic
905940856 1:41862124-41862146 CACCCAAAGGTGGCACTGACTGG + Intronic
905943584 1:41883662-41883684 CCCACCAGGCTGCCTCTGACAGG - Intronic
912449324 1:109759636-109759658 CAGCCCAGGCTGGCTATCACTGG + Intronic
914992068 1:152507442-152507464 CTCCCCAGGATGGCACTATCTGG - Intergenic
920255187 1:204649851-204649873 CACGCCAGGTTGCCTCTGCCTGG - Intronic
923511573 1:234658071-234658093 GACCCCAGCATGGCTCTAAGGGG + Intergenic
924668088 1:246094363-246094385 TACCCTAGGAGGGCTCTGATAGG + Intronic
1064636294 10:17371274-17371296 CATTCCAGGAAAGCTCTGACTGG + Intronic
1067436908 10:46284814-46284836 CACCCCCAGCTGGCTCGGACCGG + Intergenic
1067522760 10:47020660-47020682 CAGCCCAGGAAGGCTCTGCCAGG + Intergenic
1069923054 10:71829063-71829085 CTCCCCAGGACGGCTCTGGTGGG + Exonic
1070918905 10:80171867-80171889 CACCCCAGGTTGGCTGGCACTGG - Intronic
1072022668 10:91418760-91418782 GGCTCCAGGATGGCTCTGATTGG + Intronic
1072797773 10:98369360-98369382 CATGCCAGGATTGCTCTGTCAGG + Intergenic
1073758187 10:106603495-106603517 CTCCCCAGGAAGGCTCTCAGAGG + Intronic
1074554696 10:114477539-114477561 CACCTGGGGATGGCTCTGAATGG + Intronic
1075911199 10:126127123-126127145 CCCCCAGGGATGGCTCTCACAGG + Intronic
1076538398 10:131197697-131197719 CACCTCAGGTCGGCTCTGGCTGG - Intronic
1081653289 11:44839861-44839883 CTCCCCAGGATGGCTCTCCTGGG + Intronic
1081731357 11:45373945-45373967 CACCCCTCGATGCCTCTGATAGG - Intergenic
1082847248 11:57736407-57736429 CAGCCCAGGATGGCTTTGAATGG - Intronic
1083609450 11:63998131-63998153 CCCACCAGGATGGCACTGCCCGG - Exonic
1083639184 11:64136170-64136192 CAGCCCAGGATGGGTGTGTCTGG - Intronic
1083820756 11:65170146-65170168 CCCCCCAGGAAGGCCCTGATTGG + Exonic
1084266746 11:68008910-68008932 CACAGCACGCTGGCTCTGACAGG + Intronic
1084560432 11:69902542-69902564 CTCCCCGGGATGGCTGTGCCTGG + Intergenic
1084740575 11:71136801-71136823 CACACCAGGATGGTGGTGACAGG + Intronic
1086107202 11:83158229-83158251 CACCCCAAAATGGGGCTGACGGG - Intronic
1087752669 11:102023189-102023211 CACGCCAAGATGGCTCTGAGAGG - Intergenic
1088706284 11:112467183-112467205 CAGCCCAGGAGTCCTCTGACTGG - Intergenic
1089105246 11:115997660-115997682 CATCCCAGGATGCCAGTGACTGG + Intergenic
1089642993 11:119859837-119859859 CACTCCAGATTGGCCCTGACAGG - Intergenic
1090225978 11:125072531-125072553 GGCCCCAGGGTGGCTGTGACGGG - Intronic
1090379823 11:126318593-126318615 CATCCCTGGCTGGCTCTGCCTGG + Intronic
1090754183 11:129774115-129774137 AACCAAAGGATGGCTCTGATAGG + Intergenic
1091795291 12:3294495-3294517 CTGCCCAGGCTGGCTCTGGCAGG + Intergenic
1097191676 12:57222409-57222431 CACCCCAGCCAGGTTCTGACTGG + Intronic
1097195975 12:57242687-57242709 CACCCCAGCCTGCCTCTCACTGG + Intergenic
1098390720 12:69967072-69967094 CACCCAAGGATGAGTGTGACTGG - Intergenic
1100245466 12:92752605-92752627 CACCTGAGGATGGCCCTGAAGGG + Intronic
1103118754 12:118362404-118362426 CACCCCAGGATGGCTTTGAATGG - Intronic
1103945987 12:124526696-124526718 CACCCCAGGCTGGCTTTGCTGGG - Intronic
1104935024 12:132359899-132359921 CACCCCAGGATGGGTCAGGATGG + Intergenic
1105426001 13:20295699-20295721 CCCCCCAGGATGTCCCTGCCGGG - Intergenic
1105597028 13:21848541-21848563 CATTCCAGGATGGCCCTGACCGG - Intergenic
1105833134 13:24183531-24183553 CAGCCCAAGATGGCTTTGAATGG + Intronic
1106473390 13:30077513-30077535 CTCCCCAGTGTGGCTCTGAATGG - Intergenic
1113416698 13:110133840-110133862 CCCCCCAGGATGGCTCTCTATGG - Intergenic
1118582745 14:67319683-67319705 CAGCCCAGGACGGCTTTGAATGG - Intronic
1119774271 14:77238871-77238893 CACCCCGGGGTGGCTCTCCCTGG + Intronic
1121016110 14:90550223-90550245 AACCACAGGCTGGTTCTGACTGG + Intronic
1124880766 15:33640440-33640462 CACCCCAGGAATGGTCTGAGCGG + Intronic
1131156578 15:90079659-90079681 GACCCCATGATGGAGCTGACAGG + Exonic
1132464226 16:70377-70399 CACCTCTGGAGGGCTCTGACTGG - Intronic
1132854262 16:2037818-2037840 CACCCCAGGATGGCAGTGCCTGG + Exonic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1135207645 16:20496086-20496108 CTCCCCAGGATGCATCTGAGGGG - Intergenic
1135211240 16:20527546-20527568 CTCCCCAGGATGCATCTGAGGGG + Intergenic
1135712144 16:24726963-24726985 CAGCCCAGGAGGGCTCAGATGGG + Intergenic
1136100078 16:27987586-27987608 CACCCAGGGATGGCTATGAAAGG - Intronic
1138392859 16:56682916-56682938 CAGCCCAGGAAGGCTAAGACAGG - Intronic
1138581637 16:57945391-57945413 GACCCCAGGAAGCCTCTGGCTGG - Intronic
1139251330 16:65499299-65499321 CACCCAAGGATTGCACTGCCTGG + Intergenic
1141962808 16:87420846-87420868 GGCCCCAGAATAGCTCTGACGGG - Intronic
1142415051 16:89936651-89936673 CACCCCAGGAAGGGGCTGCCGGG - Intergenic
1142639699 17:1278984-1279006 CACCCCAGAATCGTTCTGATGGG + Intergenic
1143597378 17:7923368-7923390 CAACCCAGGATGGCTCTATCAGG - Intronic
1144255878 17:13466673-13466695 CACCCAAGAAAGACTCTGACAGG - Intergenic
1147841889 17:43377637-43377659 CACCCCAGCCTCGCTCTGACAGG + Intergenic
1151558083 17:74856917-74856939 CTCCCCAGGGTGGCACTGAAAGG + Intronic
1152200183 17:78940935-78940957 TACCTGAGGATGGCTCTGATTGG + Intergenic
1152292878 17:79450437-79450459 CATCCCAGGATGGCTCCGATGGG - Intronic
1152804098 17:82346890-82346912 CTCCCCAGGAGGGCTCCGAGGGG + Intergenic
1153948608 18:10038358-10038380 CAACCCAGGATGGCTATGCCAGG - Intergenic
1156485628 18:37463889-37463911 CAGCCCTGGATGGCCCTGCCAGG - Intronic
1157294594 18:46433498-46433520 CACCCCAGGTTGGTGCTGCCTGG + Exonic
1157682309 18:49616603-49616625 CACCCCAGGTAGGCAGTGACTGG - Intergenic
1157905881 18:51569722-51569744 CACCCCAGGATCCCTGTGACTGG - Intergenic
1160356594 18:78232421-78232443 CACACCAAGATGGCGCTGACAGG - Intergenic
1160424010 18:78768001-78768023 CTCCCCAGCTTGGCTCTGAGGGG + Intergenic
1160890120 19:1373338-1373360 CCCCCCAGGAAGGCTGTGCCCGG + Intronic
1163137514 19:15323356-15323378 CAGCCCAGTATGGCCCAGACTGG + Intronic
1163512167 19:17741771-17741793 CACCTCAGGGTGCATCTGACTGG - Intergenic
1163523686 19:17807572-17807594 CAACCCCTGTTGGCTCTGACAGG - Intronic
1165902941 19:39177297-39177319 GTCCCCAGGTTGGCTCTGATTGG + Intronic
1166009875 19:39934449-39934471 CACCCCAGGCTAGCTGAGACAGG - Intronic
1166458132 19:42961420-42961442 AACACCAGGATGGCTATGGCAGG + Intronic
1166695242 19:44848107-44848129 TCCCCCAGGATGGCTCTCACTGG + Intronic
1167704899 19:51075799-51075821 CACCCTTGGATGGGTCTGCCTGG - Intergenic
925100229 2:1237950-1237972 CAGCCCAGGATGGCACCGACTGG + Exonic
925404833 2:3599324-3599346 CACCACAGGACGGCACTGAATGG + Intronic
928327572 2:30332364-30332386 CACCTCAGGAATGCTGTGACAGG - Intergenic
931244000 2:60477843-60477865 AGCCCCAGGAAGGCTCTGTCAGG + Intronic
932451549 2:71813746-71813768 CACACCAAGAGGTCTCTGACAGG - Intergenic
932596432 2:73096394-73096416 CACCCCTGTCTGTCTCTGACTGG - Intronic
936403887 2:112185607-112185629 CACCCCAGGATGGCAAAGCCAGG + Intronic
937268321 2:120631306-120631328 CAACTCAGAATGTCTCTGACTGG - Intergenic
937835904 2:126470046-126470068 CTTCTCTGGATGGCTCTGACAGG - Intergenic
942251040 2:174047928-174047950 CACCCCAGGGCCGCTCTGCCAGG - Intergenic
944349494 2:198710047-198710069 CACCTTAGGATGAGTCTGACAGG + Intergenic
947582519 2:231330469-231330491 CACCCCAGGAAGGGTGTGAGGGG + Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
1171396468 20:24837085-24837107 CAGCCCAGGAAGGGTCTGCCTGG + Intergenic
1174119040 20:48248558-48248580 CTTCCCCGGATGGCTCTGGCAGG - Intergenic
1176096029 20:63344994-63345016 CACCCCCGGGTGCCTGTGACCGG - Exonic
1179994683 21:44968415-44968437 CACCCCAGGACGGCTCAACCAGG + Intronic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181141777 22:20810746-20810768 CACCTCAGGGTGCCTCTGACTGG - Intronic
1182000834 22:26918385-26918407 CAGCCCAGCTTGGCTCTGATTGG + Intergenic
1182829239 22:33291284-33291306 GACTCCAGGATGGGTCTGATTGG - Intronic
1185408948 22:50672851-50672873 CTCCCCAGGACGCCACTGACCGG - Intergenic
950121671 3:10485912-10485934 CACCCCACAATGGCCCTGAGCGG + Intronic
950449652 3:13058560-13058582 CTCCCCTGGATGGTGCTGACTGG - Intronic
950546897 3:13643540-13643562 CACCCCTGGGTGGCACTAACAGG + Intergenic
953100340 3:39819494-39819516 CACCCTAGGATGGGTGAGACAGG - Intronic
953905731 3:46867480-46867502 CTCCCCAAATTGGCTCTGACAGG - Intronic
955330731 3:58044879-58044901 GACTCGAGGATGGCTTTGACTGG + Intronic
958998007 3:100927997-100928019 GGCCTCAGGATGGTTCTGACTGG - Intronic
961667828 3:128504571-128504593 TCAGCCAGGATGGCTCTGACTGG - Intergenic
961819833 3:129570365-129570387 CACCCCAGGATGGCTCTGACTGG - Intronic
963863709 3:150336994-150337016 CATCCCAGGACTGCTCTGAGAGG + Intergenic
968336355 3:197916954-197916976 CGGCCCAGGATGGCTTTGACTGG - Intronic
968533742 4:1111387-1111409 TTCCCCTGGATGGCTCTCACAGG + Intronic
968945180 4:3659895-3659917 CTCACCAAGATGGCTCTGCCTGG + Intergenic
969541034 4:7788983-7789005 CACTGCAGGATGCCTCTGACAGG + Intronic
969704503 4:8784514-8784536 CTCCCCTGGATGGCCCTGGCTGG - Intergenic
969927336 4:10597250-10597272 CACCCCAGGAAGGCTTGGCCAGG + Intronic
970508728 4:16758978-16759000 CAGCCCTAGTTGGCTCTGACAGG - Intronic
974985509 4:69020357-69020379 TGCACCAGGATGGCTCTGAAAGG - Intronic
980104834 4:128577781-128577803 CGGCCCAGGATGGCTTTGAATGG - Intergenic
981681902 4:147409006-147409028 CACCCCAGGAAGCATCTGAGTGG + Intergenic
984059841 4:174978035-174978057 CACCCGAGGTTGGCTCTGGGAGG - Exonic
985481088 5:111328-111350 CTCCCCAGGATGACTCCCACTGG - Intergenic
987184917 5:15407483-15407505 CACCCCCGGATGGGACTGTCTGG - Intergenic
987380327 5:17279117-17279139 CATCCCAGGATGGCCCTTCCTGG + Intergenic
989175506 5:38521536-38521558 GACCCCAGGATGGCATTCACTGG + Intronic
990051796 5:51511263-51511285 CAGCCCAGTATGGCTTTGAATGG + Intergenic
997429438 5:133827272-133827294 CACACCTGGCTGCCTCTGACAGG + Intergenic
998779594 5:145641663-145641685 CCCCCCAGGGGGGCCCTGACAGG + Intronic
999091372 5:148939129-148939151 CACCTCATGATGGTTCTGGCTGG + Intronic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
999331725 5:150678026-150678048 CACCCCATGCTGGCCCTCACTGG - Exonic
999697940 5:154202849-154202871 CACCCCAGGCTGACTCTGCTGGG - Intronic
1000239337 5:159394910-159394932 CACCCCGGGACTGCTCTGATGGG - Intergenic
1001837333 5:174843441-174843463 TGACCCAAGATGGCTCTGACAGG - Intergenic
1002000904 5:176195835-176195857 CACCCCAGGACCCCCCTGACAGG - Intergenic
1002253430 5:177943137-177943159 CACCCCAGGACCCCCCTGACAGG + Intergenic
1003417255 6:5921747-5921769 CCACCCAGCATGACTCTGACAGG - Intergenic
1005418928 6:25629420-25629442 CAACTCAGGATGGCTGTGAAAGG + Intergenic
1006433864 6:34015726-34015748 CAGCCCAGGTTGTCTGTGACTGG - Intergenic
1006635644 6:35459514-35459536 CACCCCAGAGTGGCCCTGGCAGG + Intronic
1006830085 6:36963354-36963376 GACCCCAAGATGTCCCTGACAGG + Exonic
1006988845 6:38195562-38195584 AACCCCATACTGGCTCTGACTGG + Intronic
1007703881 6:43779804-43779826 CACCTCAGGATGTCTGTCACAGG - Intronic
1009040117 6:58165932-58165954 CATCTCAGGGTGGCTCTGAGAGG + Intergenic
1009216008 6:60920789-60920811 CATCTCAGGGTGGCTCTGAGAGG + Intergenic
1013473513 6:110486912-110486934 TTCCCCAGGCAGGCTCTGACTGG - Intergenic
1015448631 6:133338465-133338487 TATTCCAGGATGGCTCTGTCAGG + Intronic
1016885651 6:148957070-148957092 CAACCCAGGATGGACATGACTGG + Intronic
1018038201 6:159899371-159899393 CACCCCAGGCTGTCACTGCCAGG + Intergenic
1018698095 6:166406123-166406145 CACCCCAGGATCAGTCTGATGGG - Intergenic
1019797564 7:3063103-3063125 CAGCCCAGGATGGCAATCACAGG + Intergenic
1019906361 7:4068108-4068130 CAGACCAGGCTGGCTCTCACTGG - Intronic
1020989551 7:15179950-15179972 AATCCCAAGATGGCTCTGAGTGG + Intergenic
1024637449 7:51302003-51302025 CTCCCCTGGTTGGCTCTGACAGG + Intronic
1029600159 7:101558653-101558675 CAGCCCAGAACAGCTCTGACTGG + Exonic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038027852 8:23608209-23608231 CAACTTAGGATGGCTCTGAAGGG - Intergenic
1038326440 8:26576571-26576593 CATCCCAGCATGGCTTGGACAGG + Intronic
1039434076 8:37547605-37547627 CAGCCCAGGTAGGCTCTGCCAGG + Intergenic
1047389239 8:124436854-124436876 CACCCCAGGATGGATGTAACAGG + Intergenic
1049385582 8:142341445-142341467 CATCCCAGGAGGGCCCTGGCAGG + Intronic
1053392096 9:37743138-37743160 CATCCCAGGATGGATCTTTCTGG - Intronic
1053612085 9:39724321-39724343 CACCACAGCATGGCTCTGGCTGG + Intergenic
1053870119 9:42482313-42482335 CACCACAGCATGGCTCTGGCTGG + Intergenic
1054241433 9:62618072-62618094 CACCACAGCATGGCTCTGGCTGG - Intergenic
1054555561 9:66652595-66652617 CACCACAGCATGGCTCTGGCTGG - Intergenic
1054957742 9:70932777-70932799 AACCACAGGATGCCTCTGAAGGG + Intronic
1056183366 9:84107344-84107366 CACCACAGCTTGGCTCTCACTGG + Intergenic
1057020333 9:91692449-91692471 TACCCCATGATGACCCTGACAGG - Intronic
1057157461 9:92855806-92855828 CTCACCTGGACGGCTCTGACTGG + Exonic
1057282285 9:93721611-93721633 CACACCAGGCTCTCTCTGACTGG - Intergenic
1060190381 9:121588738-121588760 CAGCTCAGGATGACTCTGAAGGG - Intronic
1062136940 9:134934093-134934115 CAGCCCAGGATTCCACTGACGGG + Intergenic
1062556753 9:137116248-137116270 CTACCCAGCATGGCTCTGCCAGG + Intergenic
1203786719 EBV:132346-132368 CCCCCCTTGATGGCTCCGACCGG - Intergenic
1185457734 X:319180-319202 CACCGCGGGATGGGTCTGCCAGG - Intergenic
1185562369 X:1069590-1069612 GACCCCAGGATGGGGCTGAGAGG + Intergenic
1188906134 X:35793895-35793917 CACCCCAGTATACCTCAGACAGG + Intergenic
1189254859 X:39629985-39630007 CAGCCCAGGATTGTTCTGACTGG + Intergenic
1189759589 X:44307177-44307199 CACCCCAGCATGGATCTGGGTGG + Intronic
1190466396 X:50728388-50728410 GACCCCAGGAGGGCTCTGCTTGG - Intronic
1190641146 X:52483291-52483313 CACCCCAGGGCGGCTCGGTCTGG - Intergenic
1190646526 X:52529574-52529596 CACCCCAGGGCGGCTCGGTCTGG + Intergenic
1192361667 X:70444838-70444860 GTCCCCAGGATGGATCTGAGTGG - Intergenic
1195305005 X:103573443-103573465 CATCCCAGGAAGGCTCTTATTGG - Intergenic
1200052480 X:153442342-153442364 AACCCCAGGATGGGACAGACAGG - Intergenic
1201145289 Y:11061493-11061515 CACACCAGGATGGTGGTGACAGG + Intergenic