ID: 961820612

View in Genome Browser
Species Human (GRCh38)
Location 3:129573867-129573889
Sequence CTGGAGGCTCAGGTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 0, 2: 5, 3: 92, 4: 733}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961820598_961820612 21 Left 961820598 3:129573823-129573845 CCCAGCAGGGCACAGCCGTGCAG 0: 1
1: 0
2: 1
3: 18
4: 222
Right 961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 92
4: 733
961820600_961820612 6 Left 961820600 3:129573838-129573860 CCGTGCAGACCCACTGCTTAGAG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 92
4: 733
961820604_961820612 -4 Left 961820604 3:129573848-129573870 CCACTGCTTAGAGGAAGGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 301
Right 961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 92
4: 733
961820599_961820612 20 Left 961820599 3:129573824-129573846 CCAGCAGGGCACAGCCGTGCAGA 0: 1
1: 0
2: 3
3: 17
4: 237
Right 961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 92
4: 733
961820603_961820612 -3 Left 961820603 3:129573847-129573869 CCCACTGCTTAGAGGAAGGTCTG 0: 1
1: 0
2: 1
3: 15
4: 121
Right 961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 92
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961820612 Original CRISPR CTGGAGGCTCAGGTGGGGCT GGG Intronic
900132212 1:1091951-1091973 TTGGAGGCACGGGTGGGGCGAGG + Intronic
900172147 1:1274246-1274268 CTGGAGGCTCAGTGGAGGGTTGG + Intergenic
900244204 1:1630127-1630149 TTGGAGGCAGAGGTGGGGCCCGG - Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900394850 1:2449047-2449069 GAGGAGGCTCAGATGGGTCTGGG + Intronic
900514465 1:3074716-3074738 CAGGAGGCTCAGGTTGGCCCGGG + Intronic
900592284 1:3465435-3465457 CTGGAGGCCGAAGGGGGGCTGGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901049757 1:6420186-6420208 CAGGAGGGCCAGGTGGGGCCAGG + Intronic
901062050 1:6476068-6476090 CTGCAGGCTAAGGAGGGGCGGGG - Intronic
901195380 1:7437200-7437222 CTGGAGGCTAAAGAGGGGCCAGG - Intronic
901198001 1:7451086-7451108 CTGGAGCCTCAGCAGGGTCTGGG - Intronic
902138855 1:14334669-14334691 CTGAAGGCTGGGCTGGGGCTGGG + Intergenic
902236999 1:15063913-15063935 CTGGAGTCTCAGGTGGGCTGGGG + Intronic
902463205 1:16595383-16595405 CAGAGGGCTCAGGTGGGGCCTGG + Intronic
902557638 1:17256405-17256427 CCGAGGGCTCAGGTGGTGCTGGG - Intronic
902687102 1:18085311-18085333 CTGCAGGCTCAGCTGAGGATTGG + Intergenic
902749458 1:18497321-18497343 CTCTAGGCTCAGCTGCGGCTGGG + Intergenic
902764318 1:18604785-18604807 ATGGTGGCTCAGGTGGGGAATGG - Intergenic
902764400 1:18605050-18605072 ATGGTGGCTCAGGTGGGGAATGG - Intergenic
903158310 1:21465343-21465365 CAGAGGGCTCAGGTGGGGCCTGG - Intronic
903557235 1:24202791-24202813 CAGGAGGCTGAGATGGGGCTCGG + Intergenic
903658614 1:24963774-24963796 CTGGAGCCTCTAATGGGGCTGGG - Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
903738722 1:25545704-25545726 CACGAGGGACAGGTGGGGCTCGG - Intronic
903830086 1:26169476-26169498 CGGGAAGCCCTGGTGGGGCTGGG + Intergenic
904033596 1:27547775-27547797 CCGGCAGCTCAGGTGGGCCTGGG + Exonic
904400569 1:30253959-30253981 GGGGAGGCTCAGGGGGCGCTGGG + Intergenic
904756362 1:32770795-32770817 CTGGTGGCTCAGAAGGGGCGGGG + Exonic
904805460 1:33128266-33128288 CTGGAGGCTGAGGTGGGAGGAGG + Intergenic
905028613 1:34867037-34867059 CTGGAGCCTAAGGTGGGGCTGGG - Exonic
905277371 1:36827246-36827268 CCAGAGGCTGAGATGGGGCTTGG - Intronic
905590787 1:39161474-39161496 CAGGAGGATCAGTTGAGGCTAGG + Intronic
905653905 1:39673629-39673651 CTGGGAGCTGAGCTGGGGCTGGG - Intergenic
905683258 1:39889788-39889810 CTGGAGGATCACTTGGGGCCAGG - Intergenic
905694133 1:39962578-39962600 CTGGAGGCCCTGGTGGCCCTGGG + Intronic
905888127 1:41502667-41502689 CTGGAGACTCCGGTGGGGTGTGG - Intergenic
907375430 1:54034236-54034258 CTGGAGGGTGAGATGGGGGTAGG + Intronic
907441604 1:54481963-54481985 TTGGAGGCACGGGTGGGGCGGGG - Intergenic
908270896 1:62421718-62421740 GTGGAGGATCATTTGGGGCTGGG + Intergenic
908339235 1:63159425-63159447 CTGGAGCCTTTGGAGGGGCTGGG + Intergenic
908445635 1:64196767-64196789 CAGGAGGCTCAGGCAGGGCCAGG + Intergenic
910312556 1:85841230-85841252 CTCGAGGCCCAGGTGGTCCTAGG + Exonic
910748822 1:90605187-90605209 CTGAAAGCCCAGGTGGGCCTGGG - Intergenic
910772063 1:90840847-90840869 CTGAAAGCTCTGGTGGGACTTGG - Intergenic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
912678198 1:111705913-111705935 CTCCAGGCTCCGGTGGGGCTGGG + Intronic
913256326 1:116957303-116957325 CTGGAGGCTAAGGAAGAGCTGGG + Intronic
913543898 1:119847824-119847846 CAGAGGGCTCAGGTGGGGCCTGG + Intergenic
913639875 1:120802221-120802243 CAGAGGGCTCAGGTGGGGCCTGG - Intergenic
914212623 1:145594294-145594316 CAGAGGGCTCAGGTGGGGCCTGG + Intergenic
914247271 1:145895657-145895679 CTGGATGCACAGGTGGGCCTGGG + Exonic
914278605 1:146148117-146148139 CAGAGGGCTCAGGTGGGGCCTGG + Intronic
914539653 1:148599065-148599087 CAGAGGGCTCAGGTGGGGCCTGG + Intronic
914627025 1:149472563-149472585 CAGAGGGCTCAGGTGGGGCCTGG - Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915441501 1:155948096-155948118 CTGCAGGCTCAGGGGGCTCTGGG + Intronic
916175658 1:162036149-162036171 CTGGAGGCTCAGGGAGGCCATGG - Intergenic
917110283 1:171540655-171540677 CTGGTGGCTGAGGTGGTGGTGGG - Exonic
917186210 1:172359048-172359070 CTGGTGGCTCAGACGGGGCCTGG + Intronic
920186120 1:204160491-204160513 CTGGAGGGTCAGGAGAGGCCTGG + Intronic
920218846 1:204380644-204380666 CTGGTTGCTCAGGTTGGACTGGG - Intergenic
921559984 1:216645642-216645664 CTGGAGGATCACTTGGGGCCAGG + Intronic
921897523 1:220415755-220415777 TGGGAGGCTGAGGTGGGGGTTGG + Intergenic
922426769 1:225504234-225504256 CTGGAGGATCATTTGGGGCCCGG - Intronic
922539525 1:226408224-226408246 CTGGGGGCCGAGGCGGGGCTTGG + Intergenic
922749619 1:228064422-228064444 CTGCAGGCTCCGGGGGGGTTGGG - Intergenic
922752941 1:228079376-228079398 CTGGGGGGTGAGGTGGGGATAGG - Intergenic
922819115 1:228471635-228471657 CTGGAGGATCACTTGGGGCCAGG + Intergenic
923176056 1:231466838-231466860 CAGGAGGATCACTTGGGGCTGGG - Intergenic
923445569 1:234067717-234067739 CTGGAGGCTCAGCTCGGGCTAGG - Intronic
923658647 1:235939951-235939973 CTGGAGGATCATGTGAGTCTGGG + Intergenic
924105212 1:240642712-240642734 CTGGAGGATCAGTTGGGACCAGG - Intergenic
1063153240 10:3355641-3355663 CTGAAGGCCCAGGTGGGGTAGGG + Intergenic
1063157610 10:3394884-3394906 CTGAAGGCTCAGGTGGGGAAGGG + Intergenic
1063445340 10:6110602-6110624 GCTGACGCTCAGGTGGGGCTTGG + Intronic
1063568827 10:7195844-7195866 CTGGACGCTCATGTGGGCCAGGG + Intronic
1064179549 10:13102278-13102300 CTGGTGGGTCAGTTGGGCCTGGG + Intronic
1064225822 10:13483846-13483868 CTTGGGGCTCAGGAGGGGATAGG + Intronic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1065005205 10:21373294-21373316 CTGAATGCTTAGCTGGGGCTGGG - Intergenic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066189070 10:33038729-33038751 CTGGAGGATCAGTTGAGGCCAGG + Intergenic
1066638802 10:37534666-37534688 GTGGAGGGCCAGGTGGGGCTCGG + Intergenic
1067012556 10:42728008-42728030 CTGGAGGGTCAGCTGAGGCCAGG + Intergenic
1067281821 10:44879186-44879208 CTCCAGGCTGAGGAGGGGCTCGG - Intergenic
1067285606 10:44905561-44905583 CTGAAGGTTCAACTGGGGCTGGG + Intergenic
1067298640 10:44990571-44990593 CTCCAGGCTGAGGAGGGGCTCGG + Intronic
1067311035 10:45113880-45113902 CTGGAGGGTCAGCTGAGGCCAGG - Intergenic
1067343839 10:45424160-45424182 CTGGGGGCCCAAGTGGTGCTGGG + Intronic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069490663 10:68857794-68857816 CTGGAGCCTGAGGTGGTGGTGGG + Intronic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1069678653 10:70267759-70267781 CTGGAGGCTCAATGGAGGCTGGG + Intronic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1069833833 10:71296495-71296517 ATGGAGGCTCAGGGAGGGTTGGG - Intronic
1069916787 10:71791396-71791418 CTGGAGCCTCAGGTTGGACACGG + Intronic
1072416138 10:95248473-95248495 CTGGAGGATCACTTGAGGCTGGG - Intronic
1072731671 10:97850502-97850524 TTGGGGGCTCAGGTGGGGCGAGG - Intronic
1073177984 10:101568234-101568256 CTGAGGGCTCTGGTGGGGCGCGG - Intergenic
1073510128 10:104037711-104037733 CTGGGGGACCAGGTGGGCCTGGG + Exonic
1073510625 10:104040369-104040391 CTGGGGGGCCAGGTGGGCCTGGG + Exonic
1074182186 10:111075458-111075480 CTGCAGGCTTAGGTCTGGCTGGG - Intergenic
1074223894 10:111464406-111464428 CTGGAGTCTGAGGTTGGGGTAGG + Intergenic
1075325735 10:121530924-121530946 CTGGAGATTCAGGTGAGGATGGG - Intronic
1075579002 10:123602740-123602762 CAGGATGCTAAGGTGGGGCAAGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076178518 10:128387191-128387213 CTGGAGGCTCATTTAGGCCTTGG - Intergenic
1076403912 10:130200316-130200338 CTGGGGGCTCAGGAGGGGAGGGG - Intergenic
1076504340 10:130962168-130962190 CTGGGGTCTCAGGAAGGGCTTGG - Intergenic
1076589567 10:131573948-131573970 CTGGAGGGGAAGGTGGGGGTTGG - Intergenic
1076732455 10:132445523-132445545 CAGGAGGCTGAGGGCGGGCTGGG + Intronic
1076733890 10:132450421-132450443 GTGGAGGCTAGGGTGGGGCCTGG - Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077133426 11:986505-986527 ATTGAGGCTCAGGAGGTGCTGGG + Intronic
1077268891 11:1665946-1665968 CTGGAGGCTGAGGGCGGGCCCGG + Intergenic
1077271861 11:1685234-1685256 CTGGAGGCTGAGGGCGGGCCCGG - Intergenic
1077338778 11:2016950-2016972 AGGGAGCCTCAGGTGGGGGTGGG - Intergenic
1077408437 11:2392802-2392824 GAGGAGGCTGGGGTGGGGCTGGG + Intronic
1077444112 11:2582342-2582364 GTGGGGGCTCAGGTGGGCCGGGG + Intronic
1077457330 11:2688884-2688906 TTGGAAGCTGAGGTGGGGCTAGG + Intronic
1077472410 11:2770223-2770245 CTGGAGGCTGAGGTGGCTCCAGG - Intronic
1077478655 11:2802883-2802905 CTGTAGGGTCTGCTGGGGCTGGG - Intronic
1077496802 11:2890583-2890605 GTGGAGGCTCAGTGGGGGCAGGG - Intronic
1078079829 11:8195865-8195887 CTGGAGGCTCAGCTAGGGGCTGG + Intergenic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1079023489 11:16927065-16927087 CAGGAGGCTGAGGCGGGGGTGGG + Intronic
1079101344 11:17544146-17544168 CTGATGGCTCTGGTTGGGCTGGG - Intronic
1079101825 11:17546850-17546872 GTGGAAGCTGAGGTGGGGCATGG + Intergenic
1080645626 11:34185667-34185689 CTGGAGGCTGGAGTGGGGTTGGG + Intronic
1081662981 11:44899790-44899812 CTGTAGGGTCAGGTGGGACCCGG - Intronic
1081847703 11:46252597-46252619 CTGGATCCTGAGCTGGGGCTGGG + Intergenic
1081926269 11:46831619-46831641 CAGGAGGCTCACATGAGGCTGGG - Intronic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083270832 11:61571736-61571758 CTGGAGGCTCCAGGGGGCCTGGG + Intronic
1083581656 11:63828869-63828891 GTGGGGGCACAGGTGGGACTTGG + Intergenic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1083831423 11:65236316-65236338 GTGGAGCCTCAGGAGGGGATAGG - Intergenic
1084052932 11:66612733-66612755 CTGGAGGATCACTTGAGGCTAGG + Intergenic
1084399528 11:68935647-68935669 CTGGGGGCGCAGGGTGGGCTGGG + Intronic
1084412510 11:69012856-69012878 CTGGAGCCTCAGGAGTGGCAGGG + Intronic
1084442446 11:69182463-69182485 CTGGGGTCTCAGGTGTGACTTGG + Intergenic
1084484192 11:69438561-69438583 CTAGTGGCTCAGGTGTGGCCCGG + Intergenic
1084489501 11:69470917-69470939 CTGGGGGGTCTGGGGGGGCTGGG - Intergenic
1084502907 11:69545458-69545480 CTGGAGGCTCAGGAGAGGAGGGG - Intergenic
1084666203 11:70577657-70577679 CTGAATGCTCAGGTGGGGGTGGG - Intronic
1084748224 11:71186866-71186888 CTGGATGGTGAGGTGAGGCTGGG - Intronic
1088599579 11:111462693-111462715 CAGGAGGCACAGGTGGTGCTAGG + Intergenic
1089056579 11:115590544-115590566 CCTGAGGCGCAGGTGGGGCGGGG + Intergenic
1089146748 11:116335038-116335060 CTGTAGGCTCTGCTGGGGCGAGG - Intergenic
1089376074 11:117995745-117995767 CTGGAAGCTCGGGTGTGGCTGGG - Intronic
1089573281 11:119423601-119423623 CTGGAGGCTCCGGAGGAGGTGGG - Exonic
1089672776 11:120067987-120068009 ATGGAGGCACTGGTGGGGTTGGG - Intergenic
1089688262 11:120170271-120170293 CTGGAGGGTCGGGTGGGGGAGGG + Exonic
1090021740 11:123134564-123134586 TTGGAGGCTGAGGCGGGGGTGGG + Intronic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1090239722 11:125173633-125173655 CTTCAGTCTCAGGTGGGGCTGGG + Intronic
1090277325 11:125429351-125429373 CTGGGTGCTCAGGTGGGCGTGGG - Intronic
1090860868 11:130651309-130651331 CTGGAGGATCAGCTGGGGGCTGG - Intergenic
1090863306 11:130673313-130673335 CTGGAGGCGGGGGTGGGGTTGGG + Intronic
1090974547 11:131670578-131670600 ATGGAGGCTGTAGTGGGGCTGGG + Intronic
1202821762 11_KI270721v1_random:72132-72154 AGGGAGCCTCAGGTGGGGGTGGG - Intergenic
1091738974 12:2946355-2946377 CTGGGGGCTTAGGTGGGGGCAGG + Intergenic
1092936303 12:13367254-13367276 CTGTAGGGCCAGGTGGGGCCTGG - Intergenic
1093090769 12:14917753-14917775 CTGAAGGCTCAACTGGAGCTGGG - Intronic
1094468467 12:30779726-30779748 CCAGGGGCTCAGGTGGAGCTGGG + Intergenic
1094820087 12:34217793-34217815 GTGGAGGCTGCGGTGGGCCTTGG + Intergenic
1096007513 12:48184564-48184586 CTGGAGGGTGTGGCGGGGCTGGG - Exonic
1096198577 12:49664925-49664947 GTGGAGGCCCAGGTGGGGGTGGG - Intronic
1096604003 12:52752128-52752150 TTGGAAGCTCAGCTGGGGCAGGG + Intergenic
1096681736 12:53260123-53260145 CTGGAGGCTGAGGTGGAGGTGGG - Intergenic
1097192375 12:57225756-57225778 CGGGAGGCTCAGGACTGGCTGGG - Exonic
1097896810 12:64832710-64832732 CTGAAGGCTCAATTGGGGGTGGG + Intronic
1098603391 12:72360984-72361006 CTGGGGCCTGAGGTGGGGATAGG - Intronic
1098671486 12:73235593-73235615 GAGGGGGCTGAGGTGGGGCTGGG + Intergenic
1099038361 12:77618143-77618165 CTGAAGGCTCAACTGGGGCTGGG - Intergenic
1100094931 12:91022593-91022615 CAGGAGGATCAGCTGGGCCTGGG - Intergenic
1100549383 12:95632980-95633002 CAGGAGGATCATTTGGGGCTGGG - Intergenic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1101870354 12:108560832-108560854 CTGGAGGAGCAGGTGGGCCCGGG - Exonic
1102183478 12:110930785-110930807 CTGGAGGGTGAGGTGGGGGCCGG - Intergenic
1103465871 12:121141481-121141503 GGCGAGGCTGAGGTGGGGCTGGG + Intronic
1103480773 12:121248547-121248569 CAGGAGCCTGAGGTGGGGCCTGG - Intronic
1103806298 12:123576120-123576142 CTGAAGGCTCGACTGGGGCTGGG + Intergenic
1103980668 12:124734963-124734985 CAGGAGCCTCAGGAGGGCCTGGG + Intergenic
1104989648 12:132618614-132618636 CGGGTGTCCCAGGTGGGGCTGGG - Intergenic
1105376377 13:19848828-19848850 CAAGAGGCTGAGGTGGGGCTGGG - Intronic
1105619452 13:22052824-22052846 CTGGAGGCTCACTTGAGGCCAGG + Intergenic
1105668904 13:22590395-22590417 GTGGAGGCTCATGTAGGGATGGG + Intergenic
1105798910 13:23885845-23885867 CAGGAGGTTCACTTGGGGCTAGG + Intronic
1105977190 13:25482468-25482490 CTGGAAACTTGGGTGGGGCTTGG + Intronic
1106022280 13:25926770-25926792 CTGGAGGATCATGTGAGGCCAGG + Intronic
1106128769 13:26922310-26922332 CAGGTGGCTCAGGTGAGGCGAGG - Intergenic
1106520569 13:30493870-30493892 CAGGAGGCTGAGGTGGGGGAGGG + Intronic
1106758172 13:32842943-32842965 CTGAAGGCTCAGCTGGGGTTGGG - Intergenic
1107274068 13:38656969-38656991 CTGGCAGCTCAGGTTGGGGTGGG + Intergenic
1108368913 13:49747455-49747477 CTGGAGGATCACTTGGGGCCAGG + Intronic
1108461746 13:50674019-50674041 TTGGAGGCTGAGGTGGGGGCAGG - Intronic
1110313664 13:74080207-74080229 CTGGAGGATCACTTGGGCCTAGG + Intronic
1111513564 13:89297816-89297838 ATGTAGGCTCAGGTGTGTCTTGG + Intergenic
1111940568 13:94602187-94602209 CTGGAGGTCCAGGTGAGGCTGGG - Intronic
1112972220 13:105274095-105274117 CTGGAAGCCCTGGTGGGGATGGG + Intergenic
1113437315 13:110303337-110303359 CTGGGGCCTCAGTTGGAGCTGGG + Intronic
1113711344 13:112467290-112467312 CAGGAGCCCCAGGTGGGGATTGG + Intergenic
1113868808 13:113545844-113545866 GTGGAGGCTCAGGGCGTGCTGGG + Intronic
1114385387 14:22249093-22249115 CGGGTGGATCAGTTGGGGCTAGG - Intergenic
1114430913 14:22659713-22659735 AAGGAGGCTGAGGTGGGGGTAGG + Intergenic
1115102966 14:29725286-29725308 CTAGAGGCTGAGAGGGGGCTGGG + Intronic
1116822600 14:49640109-49640131 GGGCAGGCTCATGTGGGGCTTGG + Intergenic
1116938763 14:50769848-50769870 CTGGAGGATCACTTGGGGCCAGG + Intronic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1117491912 14:56256328-56256350 CTGGAGGCTGAGGTGGGAGAAGG + Intronic
1117979667 14:61329977-61329999 CTGGATGCTCACCTAGGGCTTGG - Intronic
1118807360 14:69249971-69249993 CTGGCAGCTTAGGTGGGGGTGGG + Intergenic
1118867411 14:69714313-69714335 CTGAGGGCTCAGCTGGGACTGGG - Exonic
1119234555 14:73008648-73008670 CTTGAGGATGAGGTGGGGCTTGG - Intronic
1119264519 14:73256070-73256092 CTGGTGCCTCAGCTGGGGCCTGG + Intronic
1119398882 14:74348854-74348876 CTGGAGGTGGAGGTGGGGGTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119449230 14:74694068-74694090 TTGGAGGCTGAGGTGGGGGTTGG + Intronic
1119820970 14:77616262-77616284 CTGGAGGCTCAAGGACGGCTCGG - Intronic
1120627919 14:86852420-86852442 ATGTGGGCTCAGGTGAGGCTGGG - Intergenic
1121012955 14:90532799-90532821 GTGGAGGTTCAGGCTGGGCTGGG + Exonic
1121223281 14:92302413-92302435 CTGGAGGCTGAGGTGGAGGATGG + Intergenic
1121638300 14:95468422-95468444 CTGGAGGCTCAGCTGGGCCCTGG - Intronic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122059732 14:99128993-99129015 CTGGAGGCTCAGGTGGGTGAAGG + Intergenic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1122408859 14:101516019-101516041 CTGGCTGTTCAGGTGGGGCTGGG - Intergenic
1122793798 14:104195604-104195626 CAGGAGACGCAGGTGAGGCTGGG + Intergenic
1122795059 14:104201853-104201875 GTGGTGGGCCAGGTGGGGCTGGG - Intergenic
1123008858 14:105337697-105337719 CAGGGGGCTCAGGTGGGCCCTGG - Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1124018860 15:25902110-25902132 CTGCAGGCTCATCTGAGGCTGGG - Intergenic
1124797401 15:32795230-32795252 CTGGGGGTTCAGGTGAGGCAAGG + Intronic
1124801002 15:32832775-32832797 ATGGAGACTCAGGTAGTGCTTGG + Intronic
1125385352 15:39130929-39130951 CTGGAGGCAAAGGTGGGGGCGGG - Intergenic
1125443977 15:39733256-39733278 CGGGAGGATCACTTGGGGCTAGG - Intronic
1127688557 15:61372186-61372208 CTGGAGGCCCAGGTGACCCTTGG - Intergenic
1128237374 15:66077518-66077540 CTGGAGGTGGAGGTGGGACTAGG - Intronic
1128694021 15:69747054-69747076 CTGGAGGCTCATGGAGGGCAGGG - Intergenic
1129181934 15:73883150-73883172 CTGGATGCTCCCTTGGGGCTGGG - Intronic
1129194626 15:73956550-73956572 GAGGAGGCTCAGGTGGGGTAAGG - Intergenic
1129198112 15:73983034-73983056 CTGGAAGCAAGGGTGGGGCTGGG - Exonic
1129549039 15:76428621-76428643 CCAGAGGCTGAGGAGGGGCTGGG + Intronic
1129615141 15:77092960-77092982 CTGGAGGATCACTTGAGGCTAGG - Intergenic
1129669387 15:77598688-77598710 CTGGAGGCTGGGATGGGACTGGG + Intergenic
1129706669 15:77798378-77798400 CTGCCAGCTCAGGTGGAGCTGGG - Intronic
1130076881 15:80696540-80696562 CTGGAGCGTCAGGTGGAGCGGGG + Intronic
1130886445 15:88096477-88096499 CAGGAGACTCAGGTGGGCCAGGG - Intronic
1130996250 15:88905987-88906009 TGGGAGGCAGAGGTGGGGCTGGG + Intronic
1132600443 16:770521-770543 CTCGAGCTGCAGGTGGGGCTGGG - Exonic
1132863031 16:2080833-2080855 CAGGTGGCTGAGGTGGGGCAGGG + Intronic
1132930628 16:2457342-2457364 CACGGGGCTCTGGTGGGGCTGGG - Exonic
1132950182 16:2557451-2557473 CTGGAGGCTCAGGCAGCGCGAGG + Intronic
1132964164 16:2642719-2642741 CTGGAGGCTCAGGCAGCGCGAGG - Intergenic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1133232559 16:4373409-4373431 CCGGAGGGTCAGATGGGGATGGG + Intronic
1133295531 16:4750111-4750133 CTGGGGGCTCAGGCTGCGCTGGG + Exonic
1134102504 16:11461966-11461988 CTGGGGGCTCACATGGAGCTTGG + Intronic
1134822341 16:17256995-17257017 CTGGGGGCTCCGATGGGGTTGGG - Intronic
1134827901 16:17299227-17299249 CTGGATGCTCTGGTGGTGGTGGG - Intronic
1135136684 16:19890074-19890096 CTGGAGTCTCAGGGGAGCCTGGG - Intergenic
1135725949 16:24854004-24854026 CCGGAGACTCAGGAAGGGCTTGG + Intronic
1136288597 16:29258459-29258481 CTGAAGGCTGGGGTGGGACTGGG + Intergenic
1137562382 16:49511048-49511070 GTGGAGGCCCAGGTGGGGACTGG - Intronic
1137769292 16:51003355-51003377 CTGGGGGCAAAGGCGGGGCTCGG - Intergenic
1138183849 16:54961769-54961791 CTGGAGTCTCAGGGGAGGCCTGG - Intergenic
1138438872 16:57022490-57022512 CTGCAGGAGGAGGTGGGGCTGGG - Intronic
1138623788 16:58232935-58232957 CTGGAGGATCACCTGAGGCTAGG + Intronic
1139491475 16:67288361-67288383 CTGGAGGCTGAGGCAGAGCTGGG + Exonic
1140247285 16:73262955-73262977 CTGGTGGCTTGGTTGGGGCTGGG - Intergenic
1140706288 16:77633282-77633304 CAGGAGGATCAGTTGAGGCTAGG + Intergenic
1140875018 16:79142789-79142811 CAGGAGGATCAGTTGGGCCTGGG - Intronic
1141227605 16:82133767-82133789 CAGGAGGCTGAGGTGAGCCTGGG - Intergenic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1141761090 16:86029177-86029199 CTGGGTGATGAGGTGGGGCTTGG - Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142094312 16:88231365-88231387 CTGAAGGCTGGGGTGGGACTGGG + Intergenic
1142112192 16:88338862-88338884 CTGGAGCCTCAGGAGGAGCGTGG + Intergenic
1142203479 16:88771934-88771956 ATAGAGTCTCAGGTGGGCCTGGG - Intronic
1142203518 16:88772054-88772076 ATAGAGTCTCAGGTGGGCCTGGG - Intronic
1142373187 16:89694256-89694278 CTGGGGCCTCAGGAAGGGCTGGG + Intronic
1142388964 16:89785727-89785749 CTGTGGTCTCAAGTGGGGCTAGG - Intronic
1142679904 17:1540989-1541011 CTGGAGGATCATTTGAGGCTGGG - Intronic
1142748460 17:1972950-1972972 CTGGAGCAGCAGGTGGGGGTCGG - Intronic
1143022832 17:3925586-3925608 TTGGGGGGTCCGGTGGGGCTGGG - Intronic
1143131528 17:4681255-4681277 CGGGAGGATCACGTGGGGCCAGG + Intronic
1143195415 17:5072617-5072639 CAGGAGGCACTGGTGGTGCTGGG - Intergenic
1143379347 17:6486322-6486344 CAGCAGGCTCTGGTGGGGGTGGG - Intronic
1143621943 17:8085892-8085914 CAGGAGTCCCTGGTGGGGCTGGG + Intronic
1143709096 17:8721502-8721524 TGGGAGGCTGAGGTGGGTCTTGG + Intergenic
1144107992 17:12003465-12003487 AAGAAGGTTCAGGTGGGGCTAGG + Intergenic
1144581919 17:16463981-16464003 CTGGGGGCTCTGGAGGGCCTGGG + Intronic
1144672961 17:17143298-17143320 CTGGAGGATGGGGTGGGGCCAGG + Intronic
1144763198 17:17718882-17718904 GTGGAGGCTGAGGAGGGGCAGGG + Intronic
1145056551 17:19707197-19707219 CTGGGGCCTCATGTGGGGCAGGG - Intronic
1145907326 17:28523680-28523702 TAGGAGCCTCAGGAGGGGCTTGG - Intronic
1146285935 17:31574163-31574185 CTGGAGGCTCACCTGGGCCTCGG + Intronic
1146301772 17:31695084-31695106 CTGGAGGATCACTTGAGGCTGGG + Intergenic
1146676004 17:34774358-34774380 CTGGAGGCTCTGGGAGGGCAGGG - Intergenic
1147570249 17:41566089-41566111 GGGGATGCTCAGCTGGGGCTGGG + Exonic
1147582490 17:41635219-41635241 CAGGAAGCAGAGGTGGGGCTGGG + Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1147951294 17:44109448-44109470 CTGTAGGCTGGGGTGGGGATGGG - Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148748764 17:49932539-49932561 CTGGGGGCTCAGGAAGGGCCTGG + Intergenic
1148874594 17:50679478-50679500 CTGTAGTCTGAGGTGGGACTTGG - Intronic
1148893939 17:50829062-50829084 CTGGGGGCTCAGGTGTTCCTGGG + Intergenic
1150002836 17:61452222-61452244 CCGGCGGCTCGCGTGGGGCTCGG + Intergenic
1150058560 17:62042920-62042942 CTGGAGGATCACTTGAGGCTAGG + Intronic
1151372400 17:73656484-73656506 GTAGAGGCCCAGGCGGGGCTTGG - Intergenic
1151386004 17:73755820-73755842 CTGGAGCCTCAGCTGAGGCCTGG - Intergenic
1151403492 17:73871659-73871681 CTGCAGGCTCAGGTGCAGCAGGG - Intergenic
1151890308 17:76947511-76947533 CTCGATGCTCAGGTCAGGCTGGG - Intronic
1151914742 17:77109329-77109351 CAGGAGGATCACGTGAGGCTGGG - Intronic
1151995326 17:77604744-77604766 GTGGAGGCTCCGCTGGGGCTGGG + Intergenic
1152072881 17:78142757-78142779 CAGGAGGCTGAGGTGGGGCCTGG - Exonic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152293615 17:79454374-79454396 CAGGAGGGGCAGGAGGGGCTGGG - Intronic
1152335464 17:79698018-79698040 CTGCAGGAGCAGGTGGGGGTGGG + Intergenic
1152408431 17:80110335-80110357 CTGGAGGCCCCTGGGGGGCTGGG - Intergenic
1152690596 17:81716126-81716148 CTGGAGCCTCAGCTGGGTCACGG - Intronic
1152699943 17:81813756-81813778 CTGGACGCCCAGCTGAGGCTGGG + Exonic
1152769313 17:82157631-82157653 CTGGGAGCTCAGGTGGGACGAGG - Intronic
1152773803 17:82187579-82187601 CGGGGGGCACTGGTGGGGCTCGG + Intronic
1152782286 17:82231705-82231727 CTGGTGCCCCAAGTGGGGCTGGG - Intronic
1152983349 18:299682-299704 CTGGAGGTTCAGATGGCCCTTGG - Intergenic
1153040762 18:811847-811869 CTGGAACCTCAGGTCGGACTTGG + Intronic
1153054864 18:935898-935920 CCTGAGGCTAAGGTGGGGCTGGG + Intergenic
1153411883 18:4802738-4802760 CTAGAGGCCCAAGTGGGGGTGGG + Intergenic
1153929319 18:9864923-9864945 CTGAAGGCTGAACTGGGGCTGGG + Intergenic
1154014461 18:10604287-10604309 CTGCACTCTCAGGTGGGGGTGGG - Intergenic
1154191012 18:12231237-12231259 CTGCACTCTCAGGTGGGGGTTGG + Intergenic
1154202568 18:12309121-12309143 CTGGAGGATCATTTGGGGCCAGG + Intronic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1154275469 18:12955936-12955958 CAGGAGGCTGAGGTGGGGCCAGG - Intronic
1155379888 18:25208783-25208805 CAGGAGGCTGAGGTGGGTGTGGG - Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1157403887 18:47407786-47407808 TTGAAGGATCAGGTGAGGCTTGG - Intergenic
1157625308 18:49045786-49045808 CTGGAGGCTAAGGAGGGGGTGGG + Intronic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1158639731 18:59193570-59193592 TGGGAGGCTGAGGTGGGGGTGGG - Intergenic
1159656131 18:71031650-71031672 CTGGAGTTCCAGGTGGGGGTGGG - Intergenic
1160145468 18:76360153-76360175 CTGGAGGCTCTGGTGGGGAGTGG - Exonic
1160214735 18:76918658-76918680 TGGGAGGCCAAGGTGGGGCTTGG - Intronic
1160479038 18:79221257-79221279 ATGAAGCCTCTGGTGGGGCTGGG - Intronic
1160619480 18:80160642-80160664 CCGAGGGCTCAGGCGGGGCTCGG - Intronic
1160763725 19:798004-798026 CCGGAAGCGCAGGCGGGGCTGGG + Intronic
1160855543 19:1215552-1215574 CTGCAGGCTGTGCTGGGGCTGGG - Intronic
1160922315 19:1526754-1526776 CTGGCGGCCAAGGTGGGGCCAGG + Exonic
1160947368 19:1650038-1650060 TGGGAGGCCCCGGTGGGGCTGGG - Intronic
1161017992 19:1992922-1992944 CTGGAGGCGGAGGCGGGGCCGGG - Intronic
1161029914 19:2052814-2052836 CTGGGGGCTCTGGTGGTCCTCGG + Intergenic
1161044344 19:2127083-2127105 CTGGGGTCTCAGGTGGGGACAGG - Intronic
1161067938 19:2247723-2247745 CAGCAGGCACGGGTGGGGCTAGG - Intronic
1161086656 19:2338635-2338657 CTCGAGGCTCGGGTCAGGCTGGG - Intronic
1161283240 19:3456761-3456783 CTCGAGGCCCAGGTGGGGTGTGG - Intronic
1161302908 19:3551548-3551570 CGGGAGGCCCAGGTGGGCCTGGG + Intronic
1161310762 19:3592910-3592932 CTGGGGGCTGAGGTTGGGCTGGG - Exonic
1161637027 19:5395356-5395378 CTGGGGGCTCCGGTGGAGCCCGG + Intergenic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161798896 19:6404394-6404416 CTGGGGTCCCAGATGGGGCTAGG - Intergenic
1162386939 19:10365471-10365493 CTGGGGGTTCAGGTTGGGCTGGG - Intronic
1162431494 19:10631552-10631574 CAGGAGGCTCAGGTGGTGACGGG + Intronic
1162570140 19:11466790-11466812 ATGGAGTCTCAGGTGGGGGGGGG - Exonic
1162925926 19:13930529-13930551 ACGGAGGCTCTGGCGGGGCTGGG - Exonic
1162936646 19:13984645-13984667 CCAGAGGCCGAGGTGGGGCTGGG + Intronic
1163034063 19:14561472-14561494 CTGGGGGCTCAGGGAGGGCTGGG + Intronic
1163358368 19:16829624-16829646 GGGGAGGCCGAGGTGGGGCTGGG - Intronic
1163372338 19:16908415-16908437 CTGGAGGCTGGGGAGGGCCTGGG - Intronic
1163472469 19:17505535-17505557 CAGGAGGGGAAGGTGGGGCTGGG - Exonic
1163714527 19:18866187-18866209 CTTGAGGCTGGGGTGGGGCCAGG - Intronic
1163771395 19:19193125-19193147 TAGGAGGCTCGGGTGGGACTGGG + Intronic
1164824740 19:31277072-31277094 CTGGAGGATCAGGAGGTGCTGGG + Exonic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1164987776 19:32661440-32661462 CTGGAGGCTGAGGTGGGAGGTGG - Intronic
1165006083 19:32808387-32808409 CTGGAGGCTGTGGAGGGGCATGG - Intronic
1165048594 19:33126374-33126396 CTGGAGGCGCAGCTGGGTCAGGG + Intronic
1165117657 19:33538670-33538692 AGTTAGGCTCAGGTGGGGCTGGG - Intergenic
1165181095 19:33970853-33970875 CAGTAGGCTTTGGTGGGGCTAGG - Intergenic
1165193675 19:34084621-34084643 CTGGAGGCTGAGGTGGGAGGAGG - Intergenic
1165433614 19:35785312-35785334 CTGAAGGCTGCGGTGGGGCACGG - Exonic
1166392684 19:42418584-42418606 CAGGAGGCTCACTTGAGGCTAGG + Intronic
1166416051 19:42595623-42595645 CTGGCAGCTGAGCTGGGGCTCGG + Intronic
1166566156 19:43766888-43766910 CTGGGGCCTCAGGTGGGCCAAGG + Exonic
1166697195 19:44858868-44858890 CAGGAGGCTCACTTGGGGCCAGG - Intronic
1166721747 19:45001264-45001286 CTGGGCGCTCAGGAGGGGTTGGG - Intergenic
1166916018 19:46196571-46196593 CTGGAGGCTCAGCTGGGGTCGGG - Intergenic
1166933535 19:46317024-46317046 TGGGAGGCTCAGGTGGGTCAGGG - Intronic
1167291884 19:48629169-48629191 CTGGGGACTGGGGTGGGGCTGGG + Exonic
1167418776 19:49390709-49390731 CCTGGGGCACAGGTGGGGCTAGG + Intronic
1167745927 19:51351839-51351861 CAGCAGGCTCAGGTAGAGCTGGG - Intronic
1167775068 19:51549389-51549411 CTGGAGGGTCAGGTGGCTCATGG + Intergenic
1168033507 19:53700534-53700556 CAGGAGGCTGAGGTGGGAGTTGG - Intergenic
1168146000 19:54420479-54420501 GTGGAGGCCCAGCCGGGGCTGGG + Intronic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168266953 19:55228515-55228537 CTGGGGTCCCAGGTGGGGGTGGG - Intronic
1168311484 19:55463221-55463243 GTGGATGCCCAGATGGGGCTAGG + Intergenic
1168325593 19:55537059-55537081 CCGGAGGGTCAGGAGGGCCTTGG - Exonic
1202678866 1_KI270711v1_random:32816-32838 CAGAGGGCTCAGGTGGGGCCTGG + Intergenic
925004779 2:433474-433496 GTGGAGGCTGAGGTGGGGACTGG - Intergenic
926167637 2:10531344-10531366 CTGGAGGCTAAGGTCGGGGCAGG + Intergenic
926704443 2:15826686-15826708 CAGGAGGCTGAGGAGGAGCTTGG + Intergenic
927192622 2:20527240-20527262 CTGGAGCCTCAGCGTGGGCTAGG - Intergenic
927676560 2:25110546-25110568 AGGGAGGCTCCGGAGGGGCTGGG - Intronic
927680759 2:25137491-25137513 CTGGCTGTTCAGGTGGGGCCTGG + Exonic
927882064 2:26695896-26695918 CAGGATGGTCAGGTGGGGCAGGG - Intronic
928614633 2:33024913-33024935 CTGAAGGCTCGACTGGGGCTGGG + Intronic
928907656 2:36384299-36384321 CTGGACGGTCAGCTAGGGCTAGG + Intronic
929866169 2:45719219-45719241 CCGGAGGCTGGGGTAGGGCTGGG - Intronic
929962462 2:46506955-46506977 CAGGAGGCTCTGGAGGGACTGGG - Intronic
930821924 2:55654801-55654823 CAGGAGGCTCACTTGAGGCTGGG - Intronic
931187584 2:59968520-59968542 CTGGAGGGGAAGGTGGGGCTTGG - Intergenic
931460543 2:62446794-62446816 CTGGAGGGTAAGGTGGGGAGAGG + Intergenic
932803566 2:74764222-74764244 CTGGAAGATCAGGTGGGGAGAGG + Intergenic
932954197 2:76332397-76332419 CAGGAGGCTCATTTGAGGCTAGG + Intergenic
933785554 2:85838424-85838446 CTTGTGGCTCAGGTGGTGCTGGG - Intergenic
933899356 2:86837948-86837970 CTGGAAGTTCACATGGGGCTGGG - Intronic
933981047 2:87551067-87551089 CTGGAGGCTGAGGTGGGAGGCGG + Intergenic
934564974 2:95333800-95333822 CTTGAGGCAAAGGTGGGACTTGG + Intronic
934659678 2:96136580-96136602 CTCAAGGCTCAGCTGGCGCTGGG + Intronic
934769042 2:96896190-96896212 CGGGAGGCCTGGGTGGGGCTGGG + Intronic
935217518 2:100986246-100986268 CAGGTGGCTGAGCTGGGGCTGGG - Intronic
935229140 2:101080879-101080901 CAGGAGGCTGAGGTGGGACGGGG - Intronic
935553591 2:104483377-104483399 CTGGTGGGGAAGGTGGGGCTGGG + Intergenic
935781206 2:106511280-106511302 CTGGAAGTTCACATGGGGCTGGG + Intergenic
936094564 2:109521964-109521986 CTGGACCCTCGGGTGGGTCTGGG - Intergenic
936312785 2:111399718-111399740 CTGGAGGCTGAGGTGGGAGGCGG - Intergenic
936522606 2:113220520-113220542 CTGGAGGGTTTGGTGGAGCTGGG + Intronic
936619673 2:114082418-114082440 TGGGAGGCTGAGGTGGGGGTGGG + Intergenic
936961923 2:118085003-118085025 CTCAACGCTCAGGTGGGGCTCGG + Intergenic
937238629 2:120446143-120446165 CTGGAGGCTGAGGTGGAACCTGG - Intergenic
937262803 2:120597163-120597185 CTGGAGGGTGAGGCGGGGCCCGG + Intergenic
937871099 2:126786951-126786973 CTGGAAGGTGTGGTGGGGCTCGG - Intergenic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
938613292 2:132971387-132971409 CTGGATGGGCAGATGGGGCTAGG + Intronic
939021061 2:136958980-136959002 ATGGAGGTGCTGGTGGGGCTAGG + Intronic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
940517139 2:154697425-154697447 CTGCAGGCTCAACTGAGGCTCGG + Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944022796 2:195126062-195126084 CCGCAGCCTCAGCTGGGGCTTGG + Intergenic
944191507 2:197009317-197009339 CTGGCGGATCACCTGGGGCTAGG - Intronic
944342674 2:198621741-198621763 CTGGAGGCTCAGGGGCAGATGGG - Intergenic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
945485080 2:210385735-210385757 CTGGAGGCTCAGGTAAGATTGGG + Intergenic
947442941 2:230139352-230139374 CTGGAGGATCACTTGAGGCTGGG - Intergenic
947500927 2:230670304-230670326 GTGGTGTCTCAGGTGGGGCGTGG + Intergenic
947535132 2:230935304-230935326 CAGGAGGCTGCGCTGGGGCTGGG - Intronic
947551668 2:231050911-231050933 CAGGAGCCCCAGCTGGGGCTGGG - Intergenic
947709379 2:232302848-232302870 CTAGAGGCTCAGGCCGGGCGTGG - Intronic
947769989 2:232662873-232662895 CTTCAGGCCCAGGTGGGTCTGGG - Exonic
948272847 2:236687534-236687556 CTGGGGGCTGCTGTGGGGCTGGG - Intergenic
948523985 2:238559276-238559298 CAGGAGGCTCGGGTCTGGCTGGG - Intergenic
948789591 2:240370407-240370429 CTGGGGCCTCAGGAGGAGCTGGG - Intergenic
948799314 2:240424312-240424334 AGGGAGACTGAGGTGGGGCTAGG + Intergenic
948902884 2:240965127-240965149 GAGGAGGCTCAGGTGGGGCGGGG - Intronic
948940989 2:241196339-241196361 AGGCAGGCGCAGGTGGGGCTTGG + Intronic
948990654 2:241552247-241552269 CTGGTGTCTCTGGTGGGGCCAGG - Intergenic
1169112843 20:3044630-3044652 CTGGAGCCTGAGGTCGGGGTAGG + Intronic
1170493055 20:16898038-16898060 CTGGGGTCTCAGGTGGGGCCTGG + Intergenic
1170604170 20:17863544-17863566 CTAGGAGCTCAGGTGGGGCTAGG - Intergenic
1170628565 20:18048618-18048640 CAGGAGGCTGAGGTGGGGGGCGG + Intronic
1171018116 20:21560243-21560265 CTGCAGCCCCTGGTGGGGCTGGG + Intergenic
1171249658 20:23638149-23638171 CTGGAGGGGCAGGGGAGGCTGGG - Intronic
1171363971 20:24611151-24611173 CTGGAGAATGTGGTGGGGCTAGG - Intronic
1171399064 20:24859955-24859977 CTGGTGGCTGTGGTGGTGCTGGG - Intergenic
1172197735 20:33103583-33103605 CTGAAGCCTTAGGTGGGGGTGGG - Intronic
1172425403 20:34852273-34852295 CTGGGGGCCGAGGTGGGGTTGGG + Intronic
1172477915 20:35252774-35252796 GAGCAGGCTCAGGTGGGGGTGGG + Intronic
1172477928 20:35252813-35252835 GGACAGGCTCAGGTGGGGCTGGG + Intronic
1172477942 20:35252851-35252873 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477956 20:35252889-35252911 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477971 20:35252927-35252949 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477985 20:35252965-35252987 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477999 20:35253003-35253025 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172478013 20:35253041-35253063 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172478027 20:35253079-35253101 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172826186 20:37788559-37788581 CTTGAGGCTCAGGGGAGGCTAGG + Intronic
1173018662 20:39248867-39248889 CTGGGGGCTCAAGGAGGGCTGGG + Intergenic
1173353078 20:42262621-42262643 CTGGAGGCAGAAGTGGGGATGGG + Intronic
1173512242 20:43639308-43639330 CAGGAGGATCAGTTGAGGCTGGG + Intronic
1174197605 20:48784752-48784774 CTGTGGGCTCAGGTGGGGTCAGG - Intronic
1174411314 20:50338540-50338562 CTGGAGCTACAGGTGGGGTTGGG - Intergenic
1175222458 20:57425331-57425353 CTGGAGGGTCAGGAGGGGCCAGG + Intergenic
1175692961 20:61079279-61079301 CAGGAGGGTCAGGAGGGGGTGGG - Intergenic
1175709791 20:61210319-61210341 CTGGAGCCTCAGGTGGGGTCAGG - Intergenic
1176195688 20:63835579-63835601 CTGGAGCGGCAGTTGGGGCTTGG - Intergenic
1176249770 20:64114950-64114972 CTGGGGGCTCAGACTGGGCTGGG + Intergenic
1176382404 21:6119911-6119933 CTGCAGGCTCAGGGGGGCTTGGG + Exonic
1176985437 21:15431018-15431040 ATGGATGCCCAGGTGGGACTGGG - Intergenic
1178524084 21:33310856-33310878 CAAGAGGCTGAGGTGGGGCCGGG + Intergenic
1178696452 21:34796918-34796940 AAGGAAGCCCAGGTGGGGCTGGG + Intronic
1179380061 21:40890170-40890192 CTGGAGGCCCAGGGAGGTCTAGG + Intergenic
1179454684 21:41490929-41490951 CCGGAGGCACAGGTGTGGCCAGG - Intronic
1179478879 21:41665419-41665441 CTGCAGGCTCAGACAGGGCTGGG + Intergenic
1179741068 21:43418328-43418350 CTGCAGGCTCAGGGGGGCTTGGG - Exonic
1179905082 21:44418558-44418580 ATGGGGGCTCCGGTGGGCCTGGG + Intronic
1179958060 21:44752071-44752093 CTGGAGGCTTAAGTGGGGGCGGG - Intergenic
1180057605 21:45367001-45367023 CTGGAGGGTCAGTGGGGCCTGGG + Intergenic
1180961528 22:19764483-19764505 CTAGAGGCTGAGGCGGAGCTTGG + Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181313228 22:21956684-21956706 CTAGTGGAGCAGGTGGGGCTGGG - Intergenic
1181522319 22:23456790-23456812 CTGCAGGATGTGGTGGGGCTCGG - Intergenic
1182145850 22:27996305-27996327 CTGGAAGCCGGGGTGGGGCTGGG - Intronic
1182355752 22:29721562-29721584 CTGGAGGCTCATTAGGGCCTGGG + Intronic
1182548675 22:31089857-31089879 ATGGAGGCTCAGGAGAGGCAGGG - Exonic
1183097479 22:35561883-35561905 GGGGAGGCAAAGGTGGGGCTCGG + Intergenic
1183461563 22:37953983-37954005 CTGGAGGCACAGGAGGGCCCAGG + Intronic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1183600907 22:38840211-38840233 ATGGAAGCCCAGGTGGGGATAGG + Intronic
1183653439 22:39171836-39171858 CTGGGGCCTCAGGTGGGACCCGG - Intergenic
1184074848 22:42169727-42169749 CCGGAGGCACAGGTGGGGACAGG + Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184279993 22:43431970-43431992 CTGAGGGCTCTGGTTGGGCTGGG - Intronic
1184383459 22:44160905-44160927 GTGGATGCTCAGGAGGGGCTGGG - Intronic
1184464925 22:44663328-44663350 CTGGAGGCTGTGGTGTGGGTGGG + Intergenic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
1184615618 22:45636227-45636249 CTGGAAGGTCAGATGGGGATGGG + Intergenic
1184679650 22:46063416-46063438 GATGAGGCTTAGGTGGGGCTTGG + Intronic
1184791529 22:46703331-46703353 CAGGAGGGGCAGGTGGGGGTTGG - Intronic
1184998582 22:48227869-48227891 CTGCAGGCTGAGGCTGGGCTTGG + Intergenic
1185031029 22:48442969-48442991 CTGGAGCCTGGGGTGGGGCTCGG + Intergenic
1185416202 22:50711864-50711886 TTGGGGGCTCAGGTGAGCCTGGG + Intergenic
949352086 3:3133864-3133886 CTGGAGGCTGGGGTGGGGTAAGG - Intronic
950006629 3:9695688-9695710 GTTGAGGCACAGCTGGGGCTGGG - Intronic
950021293 3:9789646-9789668 GTGGAGGCACTGGTGGGGCAGGG - Intronic
950102524 3:10366739-10366761 CTGAAAGCTCAGCTGTGGCTCGG + Intronic
950126965 3:10515586-10515608 CTGGGACCTCAGTTGGGGCTGGG - Intronic
950399540 3:12759669-12759691 CAGGAGGCTGAGGTTGGGCAGGG + Intronic
950631476 3:14284868-14284890 CTGGAGGCACTGGGAGGGCTTGG + Intergenic
951208785 3:19951762-19951784 CTGGAGGCTCACTTGAGGCCAGG - Intronic
951637509 3:24795768-24795790 GTGGAGGGTCAGGCAGGGCTTGG - Intergenic
952833826 3:37587909-37587931 CTGGATGCTAACGTGGGCCTGGG - Intronic
952936048 3:38399209-38399231 CGGGAGGCTGAGGTGGGGGTGGG - Intronic
953057679 3:39401233-39401255 CTGGAGGATCACTTGAGGCTAGG - Intergenic
953168684 3:40488046-40488068 AGGGAGGCCCTGGTGGGGCTAGG - Exonic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
953378278 3:42447079-42447101 CTAGAGTGTGAGGTGGGGCTGGG - Intergenic
954127231 3:48538746-48538768 CTGGAAGCTGAGGTGGGGGCTGG + Intronic
954289317 3:49641024-49641046 GGGGAGGCTGGGGTGGGGCTGGG + Intronic
956134071 3:66081840-66081862 CTGCATCCTCATGTGGGGCTTGG - Intergenic
956297016 3:67726015-67726037 CTTGAGGCACAGGTGGATCTAGG + Intergenic
956837558 3:73107924-73107946 CAGGAGGCTTGGGTGGGGCGGGG - Intergenic
956877372 3:73476828-73476850 CTGAAGGCTCAGCTGAGGGTCGG - Intronic
957015309 3:75056280-75056302 CTGGAGGATCACTTGAGGCTAGG + Intergenic
957065473 3:75518517-75518539 CGGGAGGATCACGTGAGGCTGGG - Intergenic
959399470 3:105882403-105882425 CTGGAAACTCAGTTGGGCCTGGG - Intergenic
960155221 3:114291818-114291840 CAGGAGGCTCTGGAGGGTCTGGG + Intronic
960607519 3:119522387-119522409 CTGGAGGCTGAGGAGGGGACAGG + Intronic
961287854 3:125820904-125820926 CGGGAGGATCACGTGAGGCTAGG + Intergenic
961345592 3:126261248-126261270 CTGGCGGGCAAGGTGGGGCTGGG + Intergenic
961650014 3:128412647-128412669 CTGGAGGTGCAGCAGGGGCTGGG - Intergenic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
962250989 3:133836103-133836125 CCGGGTGCTCAGCTGGGGCTGGG - Intronic
962269711 3:133968589-133968611 CTGGAGGTTAAGGAGGGGCAGGG - Intronic
962535838 3:136328079-136328101 CTGGAAGCTGAGGTGGAGCTGGG - Intronic
962574877 3:136747581-136747603 CCCCAGGCTCAGGTGGGGCCTGG - Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
964067339 3:152595726-152595748 CAGGAGGCTGAGGTGGAGGTGGG + Intergenic
964470997 3:157055472-157055494 CTGGAGGATCACTTGAGGCTGGG + Intergenic
964730225 3:159857028-159857050 CAGGTGGCTGAGGTGGGGCTAGG - Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
966361757 3:179137455-179137477 CTGAGAGCTCAGGTGGGGCTGGG - Intergenic
966411800 3:179652976-179652998 CTGCAGCGTCAGGCGGGGCTGGG - Exonic
968315629 3:197722167-197722189 CAGGAGGCAAAGGTGGAGCTGGG + Intronic
968597273 4:1491929-1491951 CTGGATACTCAGGTGGGCCCTGG - Intergenic
968656835 4:1782375-1782397 GTGGTGGCTCTGCTGGGGCTAGG - Intergenic
968733684 4:2284312-2284334 TTGGAGGATCATGTGGGGCCCGG - Intronic
968738955 4:2317549-2317571 CTGGAGGCTGAGCTGGAACTTGG - Intronic
968812249 4:2805327-2805349 CTGGAGGCCCAGGCTGCGCTTGG + Intronic
968816847 4:2825976-2825998 CAGGAGGCCCAGGGAGGGCTGGG + Intronic
968956493 4:3722292-3722314 GTGGAGGGTCAGGTGGGGCCGGG + Intergenic
968956519 4:3722360-3722382 GTGGAGGGTCAGGTGGGGGCTGG + Intergenic
969185015 4:5468440-5468462 CAGGAGGCTCAGGCAGGGCAAGG - Intronic
969335578 4:6507580-6507602 CTGGAAGCTCACCTGGGCCTGGG - Intronic
969461440 4:7331217-7331239 CTGGAGACTGCTGTGGGGCTCGG + Intronic
969566600 4:7982297-7982319 CTTGGGGCTCAGATGGTGCTGGG + Intronic
969574520 4:8029259-8029281 CTGCAAGCTCATGTGGGTCTCGG - Intronic
971381097 4:26098703-26098725 CTGAAGGCTCAGCTGGGGAAGGG + Intergenic
972366004 4:38375063-38375085 CTGGAGGTTCAGTTGGGGAAAGG - Intergenic
972751211 4:41990802-41990824 CTGGAGGGCCAGGCTGGGCTCGG + Intronic
973587944 4:52411029-52411051 CTGGGGGCTGGGGTGGGGATGGG - Intergenic
974145761 4:57945284-57945306 CTGGAGGCCAGGGTAGGGCTGGG + Intergenic
974916214 4:68182196-68182218 CTGGAAGCTGCGGTGGGGGTAGG - Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
976821901 4:89216144-89216166 CTGGGAGCTCAGCTGGGGCCAGG - Intergenic
980075243 4:128287591-128287613 CTGGTGGCTCTGGTGCTGCTGGG - Exonic
980694337 4:136336680-136336702 CTGAGAGCTCAGGTGGGGCTGGG - Intergenic
980935511 4:139221952-139221974 CTGGAGGCTCAGGGAGGGAGTGG - Intergenic
981230961 4:142354974-142354996 CTCGTGGCTCGAGTGGGGCTTGG + Intronic
981358689 4:143822188-143822210 CTGGAGGCTCACTTGAGGCCAGG - Intergenic
981540925 4:145845604-145845626 CGGGTGGCTCAGCTGGGACTGGG - Intronic
981801957 4:148668044-148668066 CTGGAGGCTCATTTGGAGATGGG - Intergenic
981956037 4:150475604-150475626 CTGTAGGCTCAGGCTGGGCTTGG + Intronic
982245760 4:153348736-153348758 CTGGAGGATCACTTGAGGCTGGG - Intronic
982490946 4:156028854-156028876 CTGGAGGCTGAGGTGGGAGATGG + Intergenic
983423763 4:167555855-167555877 CTGGAGGTGCAGGTGGGGCAAGG + Intergenic
983528334 4:168783737-168783759 CTGGAGGTAGAGGTGGGGATTGG + Intronic
983979589 4:173977822-173977844 CTGAAGGCTTGGCTGGGGCTGGG - Intergenic
984293265 4:177822239-177822261 CTCCAGCCTCAGATGGGGCTTGG + Intronic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
984959742 4:185085009-185085031 CAGAAGGGCCAGGTGGGGCTGGG + Intergenic
985379475 4:189377201-189377223 CTGGATGCTCAGCTGGAGGTAGG + Intergenic
985677758 5:1241050-1241072 GTGCAGGCTCAGGAGGGGCGCGG + Intronic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985927448 5:3029236-3029258 CTGGGGGCTCAGGGGAGGCTCGG - Intergenic
986639875 5:9861820-9861842 CTTCAGGCTGAGCTGGGGCTAGG - Intergenic
986818403 5:11437896-11437918 CTGCAAGCTCAGGGGTGGCTAGG + Intronic
987340149 5:16932871-16932893 CTGGAGGCTGAGGTGAGCCCAGG - Intronic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
990077326 5:51865131-51865153 CTGGTGGCTCAGCTGGGACTTGG - Intergenic
990436463 5:55796948-55796970 CAGGAGGCTGAGGTGGGCCTAGG - Intronic
990439680 5:55832234-55832256 TTGGAGGCAGAGGTGGGGCCTGG + Intergenic
991662858 5:68968200-68968222 CAGAAGGATCAGTTGGGGCTAGG + Intergenic
992052824 5:72956419-72956441 CGGGAGCCTCCGGTGGGGCTGGG - Intronic
992423895 5:76635733-76635755 CTGGAGGCTCATCTGAGCCTGGG + Intronic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
995568652 5:113457194-113457216 CTGGAGTTCCAGGTGGGCCTGGG + Intronic
995817777 5:116191436-116191458 CTTGGGGCTCTTGTGGGGCTCGG + Intronic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
997119092 5:131156087-131156109 TTGAAGGCTCAACTGGGGCTGGG + Intergenic
997704034 5:135930349-135930371 CTGGAGGCACAGGAGCGCCTAGG - Intronic
997883522 5:137611479-137611501 CGGGAGGCCCAGGTGGAGATGGG - Intergenic
998183813 5:139963816-139963838 CTGCATGCTGGGGTGGGGCTTGG - Intronic
998278715 5:140783778-140783800 CTTGAGTCTCAGATGGGACTTGG + Intergenic
998315041 5:141174835-141174857 CGGGAGCCGCAGGTAGGGCTGGG - Exonic
999244261 5:150144894-150144916 TTGGAGGCCCAGATGGGGCCGGG - Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999793618 5:154966804-154966826 TTGGTGGCTCAGGTGGAGGTGGG - Exonic
1000061988 5:157666264-157666286 CTGGAGGCTGAGGTGGAGGTGGG - Intronic
1001281377 5:170388845-170388867 CTGGGGGCTGATTTGGGGCTAGG - Intronic
1001433675 5:171683049-171683071 CTGGAGGCTATGGTGGGTGTGGG + Intergenic
1001636125 5:173211551-173211573 CTGGAGGCTGAGAAGGGGCCGGG + Intergenic
1001829331 5:174772518-174772540 CTGAAGGCTTGGTTGGGGCTGGG - Intergenic
1001949371 5:175805646-175805668 CTGGAAGGAAAGGTGGGGCTGGG - Intronic
1001950600 5:175814200-175814222 CCGGAGGCTGTGGTGGGGCCTGG - Intronic
1002179661 5:177424545-177424567 CTGAAGTCTCAGGAGGGGCCTGG - Intronic
1002576100 5:180175032-180175054 CTGGCAGCTCAGGTGGGGAAAGG + Intronic
1002640449 5:180628269-180628291 CTGCAGGCTCTGGGGGGGCATGG - Intronic
1002660419 5:180787791-180787813 GTGAAGGCTCAGGAGGGCCTTGG + Intergenic
1003021717 6:2515502-2515524 ATAGTGGCTGAGGTGGGGCTCGG - Intergenic
1003590339 6:7431911-7431933 TTGTGGGCTCAGGTGGAGCTGGG + Intergenic
1003645384 6:7910155-7910177 CTGGCGGCTGACGTGGCGCTCGG - Intronic
1004104331 6:12651619-12651641 CTGGAGGTTGTGGTGGGGGTAGG + Intergenic
1004300475 6:14453093-14453115 CTAGAGGCTCAGTGGGGGCATGG + Intergenic
1004641491 6:17520474-17520496 CTGGAGGTTCAGGAGAGGCTAGG - Intronic
1005868263 6:29953951-29953973 CTGAGGGCTCAAATGGGGCTGGG - Intergenic
1005987684 6:30884576-30884598 CGGGAGGCGCCGGCGGGGCTCGG - Intronic
1006135443 6:31892973-31892995 CTGGAGCCCCAGGCGGGGGTGGG + Intronic
1006139516 6:31920060-31920082 CTGGAACCTCAGGTTTGGCTTGG - Intronic
1006367089 6:33622012-33622034 CTGGAGGCTGAGTTGGGGAAGGG + Intronic
1006387495 6:33739453-33739475 CTGGAGCTTCAGCTGGGGCTGGG + Intronic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006644319 6:35505730-35505752 CGGGAAGCTGAGGTGGGGCTGGG - Exonic
1006748450 6:36361562-36361584 CTGGTGGCTCTGCTGGGTCTTGG - Intronic
1007071262 6:39040044-39040066 CTGGCAGCTCAGCTGTGGCTGGG - Intergenic
1007398746 6:41591717-41591739 CTGAAGCCTGAGGTGGGGCTAGG + Intronic
1007608086 6:43130598-43130620 CTGCAGGCTCGGGGGTGGCTGGG - Exonic
1007669498 6:43539650-43539672 CTGGAGGCCCTGGTGGCCCTGGG - Intronic
1008430454 6:51410639-51410661 CTCGAGGCTCCGATCGGGCTAGG - Intergenic
1008958269 6:57239634-57239656 CGGGAGGCTCAGGTTGGGGGAGG + Intergenic
1009878263 6:69533267-69533289 CTGGAAGCTCAGCCAGGGCTGGG - Intergenic
1011334629 6:86246592-86246614 CTCAAGGATGAGGTGGGGCTGGG - Intergenic
1012476698 6:99621514-99621536 CAGGGGGCAGAGGTGGGGCTGGG + Intergenic
1012495888 6:99832899-99832921 CTGGAGGATCACTTGAGGCTAGG + Intergenic
1014061596 6:117078228-117078250 CTGGAGGTGAAGGTGGGGCTTGG - Intergenic
1015013649 6:128382665-128382687 CTGGAGGATCACTTGAGGCTAGG - Intronic
1015520401 6:134124855-134124877 CAGGAGGCTCAGTTGAGGCCAGG - Intergenic
1015973164 6:138762956-138762978 CTGGGGGGTCAGGAGGGGCAAGG - Intronic
1016023016 6:139255553-139255575 CTGCAGGCTCAGGTGAGGCCAGG - Exonic
1016170407 6:141007510-141007532 CTAGAGGGTCAGCTGTGGCTTGG - Intergenic
1016323144 6:142870115-142870137 CTGCAGACCCAGGTGGGTCTTGG - Intronic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1016775071 6:147896349-147896371 CTGGACTCTGAGCTGGGGCTGGG + Intergenic
1017734082 6:157344952-157344974 CTGGAGTCTCATGTAGGACTTGG + Intergenic
1018701562 6:166431369-166431391 CTGCAGACTGAGGTGGGGCCTGG + Intronic
1019019075 6:168902588-168902610 CTGGAGGCTCAGGTGTGCTCAGG + Intergenic
1019190673 6:170249036-170249058 CTGGGGGCCGGGGTGGGGCTGGG - Intergenic
1019563917 7:1670482-1670504 CTGGGGGCGCAGCAGGGGCTGGG - Intergenic
1019670387 7:2274888-2274910 CTGAAGGCTCTGGTGGGCCAAGG + Intronic
1019739522 7:2665800-2665822 CTGGGGGCTCAGGAAGAGCTCGG - Intergenic
1019960174 7:4452438-4452460 CTGGAGGCCTGGGTGAGGCTGGG - Intergenic
1020087699 7:5320486-5320508 CGGGAGGCTCGGGGTGGGCTGGG - Intronic
1020865157 7:13551082-13551104 CTGGAAGCACATGTGGGCCTTGG - Intergenic
1021447299 7:20747361-20747383 CGGGAGACTCAGGTGAGCCTGGG - Intronic
1021615626 7:22500176-22500198 CTGGAGGCTCAGGCGCCGCGTGG - Exonic
1022044869 7:26614611-26614633 CTGGTGGCTCTGGTGAGGCCTGG - Intergenic
1022487901 7:30794495-30794517 CTAGGGGCACAGGTGGGGTTAGG + Intronic
1022532713 7:31076852-31076874 GTGGTGGCTGAGGAGGGGCTAGG + Intronic
1022663878 7:32390739-32390761 CGGGAGGCTGAGGTGGAGGTGGG + Intergenic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1023013606 7:35944181-35944203 TGGGAGGCTGAGGTGGGGCAGGG + Intergenic
1023333225 7:39141044-39141066 CAGGAGGCTCAGGGAGTGCTCGG - Intronic
1023656343 7:42425253-42425275 CTGGATGCCCAGGTTGGGGTTGG + Intergenic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1023965673 7:44962079-44962101 CTGGAGGCTGAGGCTGGGGTAGG + Intergenic
1023977154 7:45039092-45039114 CAGGGGGCTCAGGAGGGGCATGG + Intronic
1023983475 7:45082441-45082463 CTGGGGGCTCCAGTGGGGGTAGG + Exonic
1024077523 7:45829653-45829675 TGGGAGGCTGAGGTGGGGCAGGG - Intergenic
1025126890 7:56351759-56351781 TGGGAGGCTGAGGTGGGGCAGGG + Intergenic
1025665325 7:63580247-63580269 CGGGAGGCTCGGGGTGGGCTGGG - Intergenic
1025819173 7:64947058-64947080 CTGGAGGGCCTGGGGGGGCTTGG + Intergenic
1026764641 7:73152941-73152963 CTGGAGGATCACTTGAGGCTGGG + Intergenic
1027041111 7:74962709-74962731 CTGGAGGATCACTTGAGGCTGGG + Intergenic
1027082526 7:75239664-75239686 CTGGAGGATCACTTGAGGCTGGG - Intergenic
1027138008 7:75638615-75638637 AGGGAGGCACAGGTGGCGCTGGG - Intronic
1027358572 7:77384670-77384692 CAGGAGTGGCAGGTGGGGCTTGG - Intronic
1028376875 7:90154459-90154481 CTGGAGGCTCAGGCGCCGCGTGG + Exonic
1028477155 7:91265064-91265086 CTGGAGGCTCCGCTGCTGCTGGG + Exonic
1029128937 7:98315334-98315356 TGGGAGGCTGAGGTGGGCCTGGG - Intronic
1029139079 7:98397133-98397155 ATGTAGTCTAAGGTGGGGCTGGG + Intronic
1029142541 7:98421744-98421766 CGGGAGGCTCAGTTGAGGCCAGG - Intergenic
1029253318 7:99252232-99252254 TTGGCGTCTCAGGTGGTGCTGGG - Intergenic
1029406987 7:100381351-100381373 CAGGAGGATCACTTGGGGCTGGG + Intronic
1029478330 7:100798482-100798504 GTGGAGGCCTAGGTAGGGCTGGG + Intergenic
1032542879 7:132718254-132718276 CTGGAGGGTCATGTGGGGCCAGG - Intronic
1033015349 7:137665304-137665326 GTGGAGGCTGGTGTGGGGCTGGG - Intronic
1033107479 7:138541219-138541241 CAGGAGGCTCACTTGAGGCTTGG + Intronic
1033194477 7:139315784-139315806 ATGGAGGCTCAGGCTGGGCATGG + Intergenic
1033657512 7:143383144-143383166 CTGGAGCCCCAGGTGGATCTGGG + Exonic
1033673997 7:143519772-143519794 CTGGAGACCTAGGAGGGGCTTGG + Intergenic
1034157989 7:148971396-148971418 CTGGAGGATCACATGGGGCCAGG - Intergenic
1034207409 7:149329969-149329991 CTGGAGGTTCAGGTGTGGGGAGG + Intergenic
1034498824 7:151437328-151437350 CTGGAGCTTCAGGTGGGGAGTGG - Intronic
1035173268 7:157032764-157032786 CCTGGGGCTCAGGCGGGGCTTGG + Intergenic
1035361028 7:158314581-158314603 CTGGAGGCTCCCGTGGGGAAAGG + Intronic
1035518838 8:259839-259861 TCGGAGGCTAAGGTGGGGGTGGG - Intergenic
1035580946 8:738660-738682 CTGCGCGCCCAGGTGGGGCTGGG + Intergenic
1036192749 8:6685809-6685831 CTGGAAGCTCAGCTGGGACTGGG - Intergenic
1036212296 8:6852303-6852325 CTGGAGGCTGAGGATGGTCTTGG + Intergenic
1036217541 8:6893135-6893157 CAGGAGACTAAGGTGGGGCCTGG - Intergenic
1036387033 8:8291685-8291707 CTGGAAGCGAGGGTGGGGCTTGG - Intergenic
1036730105 8:11255416-11255438 CTGGAGGATCACGTGAGCCTAGG + Intergenic
1037417532 8:18667742-18667764 AGGGAGGCTCAGGCGGGGCAAGG + Intronic
1037420622 8:18698189-18698211 CAGGAGGCTCAGTTGAGCCTAGG - Intronic
1037595769 8:20353009-20353031 CTGGAGTTTTAGGTGGGCCTGGG - Intergenic
1037802570 8:22043496-22043518 GTGATGGCTCAGGTGAGGCTTGG + Intronic
1037806392 8:22059975-22059997 GTGGTGGGTGAGGTGGGGCTGGG + Intronic
1038585333 8:28783355-28783377 CTGGATGCTGGGGTGGGGCAAGG - Intronic
1038648296 8:29379629-29379651 CAGGAGGCTGAGATGGGCCTTGG - Intergenic
1038662878 8:29512214-29512236 CAGGAGGATCAGGTGAGGCCAGG + Intergenic
1039919352 8:41882417-41882439 GTGGCTGCTCAGCTGGGGCTGGG - Intronic
1040280351 8:46038361-46038383 GTGGAGGCTGTGGTGGGCCTTGG + Intergenic
1041713684 8:60914735-60914757 CTAGGGGCTGAGGTGGGGGTGGG + Intergenic
1042516348 8:69663108-69663130 CTCCAGGTTGAGGTGGGGCTGGG - Intergenic
1043075821 8:75698229-75698251 CTGGAGACTTGGCTGGGGCTGGG + Intergenic
1043873973 8:85464245-85464267 CTGGAGGCTCAGGTGCGCCCCGG + Intronic
1044413343 8:91909606-91909628 GGTGAGGCTCAGGTGGGGGTAGG + Intergenic
1044701546 8:94969546-94969568 CAGGAGGATCAGGTGAGCCTGGG + Intronic
1045048360 8:98300711-98300733 TTGGAGGCACAGGTGTGGCTGGG + Intergenic
1045441271 8:102214624-102214646 ATGGAAACTGAGGTGGGGCTCGG + Intronic
1049331521 8:142056561-142056583 TTGGAGGCTCCAGTGTGGCTTGG - Intergenic
1049363387 8:142224956-142224978 CTGCAGGCTCAGGTGGGGAAGGG - Intronic
1049442070 8:142614182-142614204 CTGCAGGATCACGTTGGGCTTGG + Exonic
1049536190 8:143183556-143183578 CTGAGGGCTCACCTGGGGCTCGG + Intergenic
1049587906 8:143440484-143440506 CTGGAGGCACAGGTCAGGCCTGG + Intronic
1049607471 8:143536387-143536409 CCGGAGGCTGAGGTGGCTCTTGG + Exonic
1049641467 8:143717859-143717881 CTGGAAGCTCAGGTGGGAGCTGG + Intronic
1049881627 8:145068310-145068332 CTTGAGGATCAGGTTGGGGTTGG + Intergenic
1051085836 9:13348115-13348137 CTGGAGGCTCATGTGAGGCCAGG + Intergenic
1051775591 9:20629761-20629783 CTGGAGGCTGAGGTGGGAGGAGG - Intergenic
1052127877 9:24800958-24800980 CTGGTGGCTCTGGTGATGCTTGG + Intergenic
1052695960 9:31878596-31878618 CAGGAGGATCAGTTGGGGCCAGG - Intergenic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1052996363 9:34553552-34553574 GGGGAGGCTCAGCTGGGGCCAGG - Intronic
1053037844 9:34840653-34840675 GGGGGGGCTCAGGTGGGACTTGG - Intergenic
1053904848 9:42831131-42831153 CAGGAGGCTCAGGTGGGAGGTGG + Intergenic
1055662539 9:78519809-78519831 CAGGACAGTCAGGTGGGGCTGGG - Intergenic
1055788258 9:79894403-79894425 CTGCAGTGTGAGGTGGGGCTGGG - Intergenic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1056401415 9:86231127-86231149 CTGGAGGCTCGTCTGGGGCTGGG - Intronic
1056684940 9:88751890-88751912 CGGGAGGCCCAGGTCTGGCTGGG + Intergenic
1057210396 9:93198177-93198199 CTGCAGGCTCCGGTGGTTCTGGG + Intronic
1057729087 9:97593443-97593465 CTGGAGCCTGGGGTGGGGGTAGG + Intronic
1057802824 9:98200386-98200408 GTGGGGGCTCAGGTAGGGCATGG + Intronic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058931934 9:109729238-109729260 CTGGAGGCTCAGGTGGCCATGGG - Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060231711 9:121830336-121830358 CAGAGGGCTGAGGTGGGGCTGGG + Intronic
1060359369 9:122940847-122940869 CTGAAAGCCCAGGTGGGGCTCGG + Intronic
1060569641 9:124626643-124626665 CTGGAGCTTCAGGCGGGGCGTGG + Intronic
1060826090 9:126688857-126688879 CTTGAGGATCAGATGGGGCCAGG + Intronic
1060827876 9:126696717-126696739 ATGGAGGCCGAGGTGGGGCTGGG - Exonic
1061126537 9:128680286-128680308 CTGGAGGATCACGTGAGGCCAGG - Intergenic
1061158099 9:128877287-128877309 GAGGAGGTACAGGTGGGGCTAGG - Intronic
1061282267 9:129604279-129604301 CTGGAGGGTGGGGTGGGGCCAGG - Intergenic
1061287318 9:129631444-129631466 CTGAAGGGTGAGGTGGGCCTGGG + Intronic
1061322600 9:129840402-129840424 CTGGAGGCTCAGTGGGTGCTGGG + Intronic
1061605147 9:131704405-131704427 TGGCAGGCCCAGGTGGGGCTGGG - Intronic
1061631104 9:131872654-131872676 GGGGAGGCTGGGGTGGGGCTGGG + Intronic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1061926498 9:133808462-133808484 CAGGAGGCCCAGGTGGGGTAGGG + Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1061967610 9:134025178-134025200 CTGGAGGAGGAGGAGGGGCTGGG - Intergenic
1062082246 9:134630217-134630239 CTGGGGGCTCAGGTGCTCCTTGG + Intergenic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1062707843 9:137955034-137955056 GTGAAGGCTCAGGCGGGGCTGGG + Intronic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1186510354 X:10125653-10125675 CTGGGGGCTCGGCTGGGGTTCGG + Intronic
1186581800 X:10827513-10827535 CTCAAGGCTCAGGTGGTACTGGG + Intronic
1187149703 X:16670132-16670154 CTGGAGACTGAGGTGGGAATTGG + Intronic
1187174961 X:16888036-16888058 CTGGAGGCTCACTTGAGCCTAGG - Intergenic
1188959988 X:36479377-36479399 CTGGAAACTCATGAGGGGCTAGG + Intergenic
1189848598 X:45158008-45158030 CTGGGGGGCCAGGTGGGGCGTGG + Intronic
1189957329 X:46288789-46288811 CTTGGGGCTCAGGGGGGCCTCGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195135844 X:101906688-101906710 CTGGGGGCTAATGTGGGTCTTGG - Intronic
1195592788 X:106650642-106650664 CTGGAGGATCACGTGAGGCCAGG - Intronic
1196685120 X:118504136-118504158 CTGGGGGCTGGGGTGGGGGTCGG - Intronic
1196831049 X:119775834-119775856 CTGGAGGCCCACGAGGAGCTAGG - Intergenic
1196997691 X:121402022-121402044 AGGCATGCTCAGGTGGGGCTTGG + Intergenic
1197126872 X:122957108-122957130 CTGAAAGCTCATGTAGGGCTAGG + Intergenic
1197700422 X:129595555-129595577 CTGGAGGCCCATGGAGGGCTTGG - Intergenic
1198271373 X:135059254-135059276 CTGGTGCCTGATGTGGGGCTAGG + Intergenic
1198551717 X:137752184-137752206 ATTGAGGCCCAGGTGGGGTTGGG - Intergenic
1198767947 X:140097291-140097313 GTTGATGGTCAGGTGGGGCTGGG + Intergenic
1199944730 X:152656218-152656240 CTGCAGGCTGGGGAGGGGCTGGG - Exonic
1200062558 X:153490071-153490093 CAGGAGGCTCTGGTGGGAGTGGG - Intronic
1200064632 X:153498568-153498590 CCGGGGGCTCAGGCTGGGCTGGG - Intronic
1200079000 X:153566336-153566358 CTGGTGGCTCAGGCGGGCCCTGG - Intronic
1201277380 Y:12312198-12312220 CTGGTGGCCCAGATGGGGGTTGG + Intergenic
1201357291 Y:13111544-13111566 CTAGTGGCTCAGATGGGGATTGG + Intergenic
1201944333 Y:19495876-19495898 GTGGAGGCTGAGATGGGGGTGGG - Intergenic