ID: 961823468

View in Genome Browser
Species Human (GRCh38)
Location 3:129586897-129586919
Sequence GCCTCTGCTGTGCCCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 471}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961823466_961823468 -5 Left 961823466 3:129586879-129586901 CCGGGCCTTGATGCTTCTGCCTC 0: 1
1: 0
2: 3
3: 45
4: 376
Right 961823468 3:129586897-129586919 GCCTCTGCTGTGCCCCCACCAGG 0: 1
1: 0
2: 4
3: 53
4: 471
961823467_961823468 -10 Left 961823467 3:129586884-129586906 CCTTGATGCTTCTGCCTCTGCTG 0: 1
1: 0
2: 6
3: 78
4: 566
Right 961823468 3:129586897-129586919 GCCTCTGCTGTGCCCCCACCAGG 0: 1
1: 0
2: 4
3: 53
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961823468 Original CRISPR GCCTCTGCTGTGCCCCCACC AGG Intronic
900363343 1:2300393-2300415 GCCTCTGGTGTGACCCTTCCTGG - Intronic
900406598 1:2495633-2495655 TTCTCTGCGGTGACCCCACCAGG + Intronic
900523560 1:3117539-3117561 GCCTATGCTGTCCCCACCCCCGG + Intronic
900986398 1:6075379-6075401 GCCTCTGCAGTGTCTCCATCAGG + Intronic
900993659 1:6109061-6109083 GCTCCTGCTGTGTCCCCACTTGG - Intronic
901000363 1:6146067-6146089 GCCCCTGCTGTGCCCACATGTGG + Intronic
901165842 1:7220984-7221006 GCTTCTGCTGTGCCCTCACGGGG + Intronic
901197526 1:7448408-7448430 GCCTCAGCTGAGCACCCACCTGG - Intronic
901325188 1:8361177-8361199 GCCACTGCAGTTCCCCCACAGGG - Exonic
901796373 1:11681640-11681662 GCCCCTGCTCCGCCCCCACCGGG + Intronic
901824638 1:11853011-11853033 GCCTCTGCCGTGCCCGAAACGGG + Intergenic
902726125 1:18337430-18337452 GTCTCTGATGTGCCCACTCCTGG + Intronic
903141879 1:21344198-21344220 GCCCCTGCTGTGCCCAGAGCTGG - Intronic
903334656 1:22616863-22616885 GGCTCGGCCGTGCCCCCACTGGG - Intergenic
903605273 1:24570958-24570980 GCCTCTGCTATGCCCACCACTGG + Intronic
903752678 1:25636813-25636835 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
904976955 1:34464088-34464110 CTCCCTGCTGTACCCCCACCAGG + Intergenic
905684226 1:39897449-39897471 TCCTCTTCTCAGCCCCCACCAGG + Exonic
905786203 1:40759759-40759781 GCCTGTGCTGTGCCCTCTACTGG - Intronic
906078361 1:43068294-43068316 GCCCCTGCAGTCCCCTCACCGGG + Intergenic
906308756 1:44738445-44738467 GCCTCTGCTCGGCCGCCACCCGG + Intergenic
907050766 1:51328929-51328951 TCCTCTGCTCAGACCCCACCAGG + Intronic
907110961 1:51925962-51925984 GCCTCAGCTGGCCCCCCAGCAGG - Intronic
907960020 1:59270165-59270187 GCCTCAGCTGAGCTCCCAGCCGG + Intergenic
910746571 1:90581261-90581283 GCCTCTTCTGTGCCCAAATCTGG - Intergenic
912100125 1:106193413-106193435 GCCTCTGGTGTGCAGCCCCCAGG + Intergenic
912798260 1:112705837-112705859 GCCACTGCTGTCCCCCCAGCAGG + Exonic
915070204 1:153260335-153260357 GGCTCTGCTGTGGCCCTGCCTGG - Intronic
915234418 1:154470061-154470083 GCCGCCTCTGGGCCCCCACCTGG + Intronic
915321403 1:155058291-155058313 GCCTCTGCTGGGCTCCATCCGGG + Exonic
915903055 1:159860039-159860061 GCCTCTGCAGGCCCCTCACCAGG + Intronic
917962989 1:180159061-180159083 GATTCTGCTGAGCCCCCACTGGG - Intronic
920180970 1:204131509-204131531 CCCTCTCCTGTCCCCCCAGCAGG + Exonic
921218719 1:212958298-212958320 GCCACTGCCCTGCCCCCAGCTGG + Intronic
922571371 1:226636352-226636374 GGCTTTGCTGTGCCCCTAGCAGG - Intronic
922810211 1:228411095-228411117 GCCTCTGCTCTTCTTCCACCAGG + Exonic
922962574 1:229661436-229661458 GGCCCTGCAGTGCCACCACCAGG - Intergenic
923898505 1:238299969-238299991 GCCTCTGCTTTGACTCCAACAGG + Intergenic
924345967 1:243073468-243073490 GCCTCAGCTGTCCCCATACCTGG + Intergenic
924550904 1:245075924-245075946 ACCTCTGCTGTTTCCCCACATGG - Intronic
924582063 1:245331135-245331157 GGCTCTGCTCTGCCACCCCCAGG - Intronic
1064147908 10:12840026-12840048 TCCTCAGCTGTGCTCCCAGCAGG + Intergenic
1064523033 10:16223524-16223546 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1065666706 10:28071013-28071035 CCATCTGCTATGCCCTCACCTGG + Intronic
1066228381 10:33407285-33407307 GCCTCTGCTGTGCCCTGTACTGG - Intergenic
1067053754 10:43039755-43039777 GCCTCAGGTGTCCCCCCAGCTGG + Intergenic
1067472421 10:46546681-46546703 CCCTTTGCTGTGCCCTCTCCTGG - Intergenic
1067749089 10:48958124-48958146 TCCTCTGCTGTACCCCCTACAGG - Intronic
1067749611 10:48962109-48962131 GCCTATGATCTGCCCTCACCTGG + Intronic
1069519997 10:69111396-69111418 GCCTCAGCTGTGCCCTCAACAGG - Intergenic
1069574360 10:69516410-69516432 GCCCCAGCAGTGCCTCCACCTGG + Intergenic
1069781262 10:70957201-70957223 GCCTGTGCTGTGCCTCCTGCTGG + Intergenic
1069960164 10:72074864-72074886 CCCTCTGCTCGGCCCACACCTGG + Intronic
1070148663 10:73792277-73792299 GCCTTGGCTTTGCCCCCACCTGG - Exonic
1070157663 10:73845795-73845817 CCCTCTGCTGAGACCTCACCTGG + Intronic
1071298476 10:84239623-84239645 GCCTCTGGTTTTACCCCACCCGG - Intronic
1072024700 10:91443389-91443411 GCCTCTGCTGTGCCATACCCAGG - Intronic
1072024997 10:91446206-91446228 GCCTCTGCTGTGCCATACCCAGG + Intronic
1072890082 10:99316081-99316103 GCCTCTTCTGTCCACCCACCCGG + Intergenic
1072930809 10:99659986-99660008 TCCTCTGCCGTGCTCCCAGCCGG - Intronic
1073102900 10:101016089-101016111 GCCTGTGCTGGGCCTCCACTGGG - Intronic
1073118687 10:101108196-101108218 GCCCCTGCTGTGACCCCTCCTGG - Intronic
1073136828 10:101224862-101224884 GCCGCGGCCGTGCCCGCACCGGG + Intergenic
1073588347 10:104732529-104732551 GCCTTTGCTGTGCCCCCAAGGGG + Intronic
1075746047 10:124728396-124728418 GGGTCTGCCCTGCCCCCACCAGG + Intronic
1075869792 10:125762858-125762880 GCTCCTTCTGTGCCCTCACCCGG + Intronic
1075878484 10:125828094-125828116 CCCTCTCCATTGCCCCCACCTGG - Intronic
1076454208 10:130578207-130578229 TCCCCTGCTGTGGCCCCTCCAGG - Intergenic
1076625529 10:131819387-131819409 GCCCCTGCTGTGACACCACACGG - Intergenic
1076943352 10:133625341-133625363 GGATCTGCTGTGCCCACACCTGG + Exonic
1077046024 11:545518-545540 GGCTCTGCTGTGCCTCTCCCGGG - Intronic
1077046035 11:545571-545593 GGCTCTGCTGTGCCTCTCCCGGG - Intronic
1077061201 11:618655-618677 GTCTGTGCTGTGCCCCCACCGGG + Exonic
1077061230 11:618748-618770 GTCTGTGCTGTGCCCCCACCGGG + Exonic
1077061258 11:618841-618863 GTCTGTGCTGTGCCCCCACTGGG + Exonic
1077061286 11:618934-618956 GTCTGTGCTGTGTCCCCACCGGG + Exonic
1077153722 11:1082416-1082438 GCCTCTGCTGTGCCCAGCCCTGG - Intergenic
1077168202 11:1153152-1153174 GCCCCTGCTGCAGCCCCACCCGG + Intergenic
1077998657 11:7475493-7475515 GCCAGTGCTGTCCACCCACCAGG + Intergenic
1078118501 11:8480804-8480826 GGCTCTGCTGTGCTCCATCCAGG + Intronic
1078340397 11:10494673-10494695 GCCTCTGCTGTTCCTTCACAGGG + Intronic
1078546705 11:12252321-12252343 GCCTCTACTCTGGCCCAACCTGG - Intronic
1078987195 11:16607568-16607590 CGCTCTGCGCTGCCCCCACCCGG - Intronic
1080730113 11:34941872-34941894 GCCTCTGCTCTGGCCCCTCCTGG + Intronic
1080857615 11:36125955-36125977 GCTTATGCTGGGACCCCACCAGG + Intronic
1080897073 11:36455802-36455824 GCGTCAGCTGTGTCCCCACTGGG - Intronic
1080970333 11:37266816-37266838 GCCTTTGTTGTGTCCCCACATGG + Intergenic
1083316251 11:61816522-61816544 CCCTCTCCTGTGCCCCCGCCTGG + Intronic
1083614861 11:64021362-64021384 GCCTCTGCTGTTCCCCTGACAGG + Intronic
1083846034 11:65334107-65334129 GGCTCCAGTGTGCCCCCACCAGG - Intronic
1083865957 11:65453097-65453119 GCTTCTGCTTGGCCCCTACCTGG - Intergenic
1084310040 11:68311854-68311876 GCCCCTTCTGTGCCCCTTCCAGG + Intergenic
1084326207 11:68401619-68401641 GCCTCAGCTCTGCCCCCAAGGGG - Intronic
1084705876 11:70815719-70815741 GCCTCCCCAGGGCCCCCACCGGG - Intronic
1085514630 11:77105159-77105181 CCCTCTGCTGTGCCCGCTGCAGG + Intronic
1085689597 11:78654558-78654580 TCATCTTCTGTGCCCCCTCCTGG + Exonic
1087681350 11:101221326-101221348 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1089780450 11:120869950-120869972 ATCTCTGCTGTGTCCCCACTTGG + Intronic
1089917261 11:122170138-122170160 GCCTCCTCTGTGTCCCCACATGG - Intergenic
1090837043 11:130461463-130461485 GCTTCTGCTTCTCCCCCACCCGG + Intronic
1091182829 11:133622283-133622305 TCCTCTGCTCTGCCCTCACTCGG + Intergenic
1094750168 12:33397310-33397332 GCCTCTGCTGTTACCACTCCAGG - Intronic
1095973340 12:47921063-47921085 TGCTCTGCTGTGTTCCCACCCGG + Intronic
1096239268 12:49950910-49950932 GCCTCGGCTCTGCCCTCAACTGG + Exonic
1100087571 12:90930305-90930327 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1100970521 12:100065073-100065095 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1102680115 12:114685365-114685387 CCCTGTGCTGTGCACCCAGCCGG - Intergenic
1104280340 12:127371064-127371086 GCCTCTAATGTTCTCCCACCTGG + Intergenic
1104957701 12:132474483-132474505 GCCTCTGCTGGACGCCCACCGGG - Intergenic
1104997383 12:132666931-132666953 GCCCCTGCTGTGCGGCCCCCTGG - Intronic
1105897809 13:24732203-24732225 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1106025124 13:25949011-25949033 TCCTCAGCGGTGCCTCCACCAGG + Intronic
1106216737 13:27708479-27708501 GCCACAGCTGTGCCTCTACCTGG - Intergenic
1106804844 13:33295702-33295724 GTCTCTCCTCTGCCCCCCCCGGG - Intronic
1107690508 13:42948300-42948322 GCCTCTGCTCTGCAGGCACCTGG - Intronic
1107737766 13:43416647-43416669 GCCTCTGCCCCGCCACCACCCGG - Intronic
1107740203 13:43442423-43442445 ACCTCTGCTGTGCCCACCACTGG + Intronic
1108417439 13:50212573-50212595 TTCTCTGCTGTGACCTCACCTGG + Intronic
1110953621 13:81524628-81524650 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
1112402269 13:99086921-99086943 GCCTCGGCTGTGCGCCCTCTTGG - Intergenic
1113066059 13:106375195-106375217 GCCTCTGCTATGCGCGCACAGGG - Intergenic
1113154420 13:107302196-107302218 GACTCTGCAGAGCCCACACCAGG + Intronic
1113722155 13:112567141-112567163 GCCTCTGGGGTGTCCCCAGCAGG - Intronic
1113727798 13:112618119-112618141 GCCTCTGCTGTGACCTGGCCGGG - Intergenic
1113956570 13:114102673-114102695 GCCTTGGCTGTGACACCACCTGG - Intronic
1113990601 14:16024616-16024638 GCCACTGACCTGCCCCCACCCGG + Intergenic
1114635852 14:24186375-24186397 GTGGCTGCTGAGCCCCCACCAGG - Exonic
1116898628 14:50340964-50340986 GGCTCTGCCCTGCCCCAACCTGG + Intronic
1118216403 14:63812704-63812726 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1118584606 14:67341077-67341099 GCCTCTGCCCAGCCGCCACCCGG + Intronic
1118721946 14:68600568-68600590 CCCTCTACTGTGGCCCCAGCGGG - Intronic
1120229746 14:81829598-81829620 GCCTCAGCTGCCTCCCCACCGGG - Intergenic
1121515783 14:94548947-94548969 GCCTATGCTGTTCCCCTACCTGG + Intergenic
1121569900 14:94939708-94939730 GCATCTGCATTGGCCCCACCTGG + Intergenic
1122104476 14:99441734-99441756 GCCCCTGCTGTGGCCTCATCAGG - Intronic
1122842469 14:104473136-104473158 GCCACTGCTGCCACCCCACCTGG - Intergenic
1122925145 14:104896008-104896030 GCCTCTGCCGTGGCCCCTGCTGG + Exonic
1123705317 15:22947150-22947172 GCAGCTGCTGGGCACCCACCTGG + Exonic
1124200494 15:27674841-27674863 GGCTCTGCTGTGCCCACAGAGGG - Intergenic
1125920811 15:43524582-43524604 GCATCTTCTTTGCCCACACCTGG - Exonic
1126668435 15:51094742-51094764 GCCTCTGCGGAGCCGCCCCCTGG - Intronic
1127153999 15:56109449-56109471 GCCTCTGCCTGGCCGCCACCCGG + Intronic
1127681959 15:61306167-61306189 ACCTTTGCTGTGCCTCCCCCAGG - Intergenic
1127866906 15:63041041-63041063 TCCTCTGCTGAGCTCCAACCTGG + Intergenic
1129719590 15:77870874-77870896 GCCTCTGCTGTGGGCACACTTGG - Intergenic
1129766325 15:78171306-78171328 GCCAGTGCTGTGCCCTGACCTGG + Exonic
1129856938 15:78831232-78831254 GCCACTGCTGGGACCTCACCCGG - Intronic
1130909648 15:88262290-88262312 GCTCCTGCAGGGCCCCCACCAGG - Intergenic
1131060276 15:89400119-89400141 GTCTCTGCTGGGCCCCGCCCGGG - Intergenic
1131127071 15:89867415-89867437 GCCTCTGCCCGGCCGCCACCCGG + Intronic
1131175416 15:90206242-90206264 GCCTCTGATGTGGCCCTCCCTGG + Intronic
1131396015 15:92086898-92086920 ACCTCTGCCGTCCCCACACCAGG - Intronic
1131879856 15:96851146-96851168 GCCTAAGCTGTGCCCCTACCCGG - Intergenic
1132076971 15:98830070-98830092 GTCCCTGCTGTGTCCCAACCTGG + Intronic
1132263794 15:100448698-100448720 GCCACAGCAGTGCCCCCACATGG - Intronic
1132580149 16:680872-680894 GCCCCTGCCCTCCCCCCACCCGG - Intronic
1132627510 16:898531-898553 CCCTTGGCTCTGCCCCCACCTGG - Intronic
1132665152 16:1078168-1078190 CCCTGTGCTGTGCCCCCGCCTGG + Intergenic
1132696455 16:1204284-1204306 CCCTCTGCTGTGCCCGCCGCTGG - Exonic
1132755379 16:1481979-1482001 TGCTCTGCTGTTCTCCCACCTGG + Intergenic
1132903098 16:2268817-2268839 GCGCCTGCTGTTCCCCCGCCGGG - Intergenic
1133416255 16:5609431-5609453 ACCTCTCCTCTGCCCCCAGCAGG - Intergenic
1133747347 16:8697210-8697232 GCATCTGCTGTGTCCCTGCCTGG - Intronic
1134015975 16:10888750-10888772 GCCTCTGCCCTGCCCCCACATGG + Intronic
1134716875 16:16361729-16361751 CCCTCTGCTGTGTTCTCACCTGG + Intergenic
1134957876 16:18390430-18390452 CCCTCTGCTGTGTTCTCACCTGG - Intergenic
1136598111 16:31265760-31265782 GCCTTCTCTGTCCCCCCACCAGG + Intronic
1137582135 16:49639922-49639944 GGCTCTGCTCGGCCCCCGCCGGG - Intronic
1137808249 16:51328427-51328449 GCCTGTGCACAGCCCCCACCAGG - Intergenic
1138104562 16:54280921-54280943 CTCTCTGCTGTGCCCCTGCCTGG + Intergenic
1138531013 16:57634383-57634405 TCCTCTGCTGTGTCACCATCTGG + Intronic
1139464632 16:67147785-67147807 GCCCCTGCTCTGCCCCATCCTGG + Exonic
1139490839 16:67285166-67285188 TCCCCTACTGTGCCTCCACCAGG + Exonic
1139894466 16:70277300-70277322 CCCTCTGCTTTGGCTCCACCAGG - Intronic
1141093575 16:81147230-81147252 CCCTTTGCTGTGTCTCCACCCGG + Intergenic
1141509846 16:84505073-84505095 GCCTCTGCAGTGCAGCCTCCTGG + Intronic
1141663468 16:85453849-85453871 GCCTCAGCTGAGCCCCCACCAGG - Intergenic
1142227386 16:88884265-88884287 CCTGCTGCTGGGCCCCCACCGGG + Intronic
1142248010 16:88978614-88978636 GCCTCTGCTGTCTCCACTCCCGG - Intergenic
1143388141 17:6544091-6544113 CCCAATGCTGTGCACCCACCAGG - Intronic
1143450225 17:7031851-7031873 GCCACTGCAGAGCCCCCACTGGG - Intergenic
1144584965 17:16482361-16482383 CCCCCTGCAGTGCCCCCTCCAGG - Intronic
1144742192 17:17590258-17590280 TCCTCTGCTGAGCACCCATCTGG + Intronic
1144757932 17:17691549-17691571 GCCTGGGCTGTGCCCTCAGCTGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1146789350 17:35742737-35742759 GACCTTGCTGTCCCCCCACCAGG - Exonic
1146910884 17:36647748-36647770 GCCTCAGCAGTGCCACCTCCAGG + Intergenic
1147978898 17:44262815-44262837 GCATCAGCAGTGCTCCCACCTGG - Intronic
1148351947 17:46947392-46947414 GCCTCTGCCCTGCCTCCGCCTGG - Intronic
1149295648 17:55259958-55259980 GCCTCACGTCTGCCCCCACCGGG + Intergenic
1149466955 17:56887669-56887691 GCCTCTGTTCTGACACCACCTGG + Intergenic
1149624830 17:58073795-58073817 GCCTCTGCCCGGCCACCACCCGG - Intergenic
1150252362 17:63713914-63713936 GCCTCTGCTGTACACACATCTGG + Intronic
1150656802 17:67044756-67044778 GGCTGTGCTGAGCCCCCACATGG + Exonic
1151625375 17:75272425-75272447 GCACCAGCTGTGCCCTCACCAGG + Intergenic
1151826608 17:76527478-76527500 GCTCCTGCTGTGTCCCCTCCTGG - Exonic
1152199370 17:78936098-78936120 GCCCAGGCTCTGCCCCCACCCGG - Intergenic
1152220928 17:79065281-79065303 GGCTCTGCAGTGCCCCCTTCTGG - Intergenic
1152306834 17:79526019-79526041 GCCCCTGGTGTACCCCAACCTGG - Intergenic
1152371940 17:79893632-79893654 GCCTGTGCTGTGCTGCCAGCTGG - Intergenic
1152537860 17:80960825-80960847 GCCTCTGCTGAGCACCCCCGTGG + Intronic
1152558835 17:81067841-81067863 CCATCAGCTGTGCCCCAACCGGG - Intronic
1152693717 17:81733647-81733669 GCATCGGCTGTGTCCCCACTAGG + Intergenic
1152800133 17:82327083-82327105 GCCCCTGTCATGCCCCCACCGGG + Intronic
1153498189 18:5721614-5721636 GCCTCTGCTGACCCCCAGCCTGG + Intergenic
1154444584 18:14424695-14424717 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1155873362 18:31054262-31054284 GCCTCAGCTATGCCACAACCCGG + Intergenic
1158581353 18:58686438-58686460 GCCTCTGCTCTGCCCATTCCAGG - Intronic
1158887883 18:61846012-61846034 GCATCTGCTGTGTCCTCACATGG - Intronic
1159001438 18:62978757-62978779 GCCTCCGATGAGCCCCCGCCCGG + Exonic
1159471104 18:68858124-68858146 GCACATGGTGTGCCCCCACCAGG + Intronic
1160456291 18:79004230-79004252 GAATTTGCTGTGCACCCACCAGG - Intergenic
1160689926 19:456813-456835 GCACCTGCTGTGCCCCTGCCTGG + Intronic
1160941031 19:1620616-1620638 GCCTGTGCTGTGACCTAACCTGG + Intronic
1160954170 19:1682511-1682533 GCCCTTGCTGTGCCCTCGCCTGG + Intergenic
1161106572 19:2446504-2446526 GCCTGAGCTGTGCCCCCAGCTGG - Intronic
1161251386 19:3282261-3282283 GCCTCTGGTGAGCCTCCTCCAGG + Exonic
1161313293 19:3606719-3606741 TCCTCTGCTGGGCCCGCCCCTGG - Intronic
1161494294 19:4579217-4579239 TCCTCTGCAGTGGCCACACCAGG - Intergenic
1161569993 19:5025296-5025318 TCCTCTGCGGTGCCCCAGCCAGG + Intronic
1162410409 19:10502338-10502360 GCCCCTCCTGAGCCTCCACCAGG + Intronic
1162515068 19:11142775-11142797 CCGCCTGCTGGGCCCCCACCAGG + Intronic
1162534517 19:11254860-11254882 GCACCTGCTGTGCCCCCTGCTGG - Intronic
1162817994 19:13207748-13207770 GCCGCTGCTGTGGCCCCCCGTGG + Exonic
1162824462 19:13243191-13243213 TCCACTGGGGTGCCCCCACCTGG - Intronic
1163045883 19:14641547-14641569 CTCTCTGCTGTGCCTCCTCCTGG - Exonic
1163059812 19:14752457-14752479 CTCTCTGCTGTGCCTCCTCCTGG - Exonic
1163369110 19:16892245-16892267 CCCAATGCTGTGGCCCCACCAGG + Exonic
1163572546 19:18090946-18090968 GCCTCTGCTGTGGCCTCTGCCGG - Intronic
1163687073 19:18717726-18717748 GGCCCTGCTCTGCTCCCACCCGG - Intronic
1164743375 19:30593604-30593626 GCCTTGGCTCTGACCCCACCTGG + Intronic
1165642136 19:37398668-37398690 GCCTCTGCTGTGGCTCAAGCTGG - Intergenic
1165742360 19:38211590-38211612 GCCTCTGCCGGCCCCCCGCCGGG - Intronic
1166541929 19:43611291-43611313 GCCTCTGCTCCTCGCCCACCTGG + Intronic
1167011662 19:46812950-46812972 CCCTCTGCTGGTTCCCCACCTGG + Intergenic
1167055758 19:47111205-47111227 GCCTCTTCTCTCGCCCCACCAGG + Intronic
1168259655 19:55186266-55186288 GGCTCTGCTGTTCCCACACCAGG + Exonic
925253260 2:2460690-2460712 CCCTCTGCTGTGCCTCCTGCCGG + Intergenic
925387643 2:3473222-3473244 GGCTCTGCTGTGCTCACGCCGGG + Intronic
925388782 2:3481993-3482015 GCCTCTTCTATGCCCCCTCGAGG + Intronic
926107408 2:10160881-10160903 GCCCCTGCAGTGCTCCCACCAGG + Intronic
926246003 2:11122868-11122890 GCCCATGCTGTTCCCCCACCTGG + Intergenic
926683438 2:15680628-15680650 GCCTCTGCCCGGCCGCCACCCGG - Intergenic
927515370 2:23668934-23668956 GCCCCTGCTGTGCCACTTCCGGG - Intronic
927884458 2:26710058-26710080 TCCTCTGCTGTGTCCTCAGCTGG + Intronic
927991960 2:27454169-27454191 GTCTCTCCTCTGTCCCCACCTGG - Intronic
928312716 2:30223782-30223804 ACTTCTGCTGAGGCCCCACCTGG + Intergenic
930051277 2:47218058-47218080 CCCTCTGCTGGGGCCTCACCTGG - Intergenic
930216377 2:48701461-48701483 GCTTTTGCTGTTCCCCCTCCTGG + Intronic
932395518 2:71444468-71444490 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
934035073 2:88082460-88082482 GCCCCTGCGGTGCCCTCAGCTGG + Intronic
934703352 2:96461195-96461217 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
934708464 2:96500649-96500671 GCCCTTCCTGTGCCCCGACCTGG - Exonic
934925474 2:98379335-98379357 GCATCTGCAGTGCCCTCCCCTGG - Intronic
937083568 2:119157029-119157051 GCCTTTGCTCAGCCCACACCAGG + Intronic
937275126 2:120679231-120679253 GCCTCCTCTGCACCCCCACCGGG - Intergenic
938375037 2:130799323-130799345 GGCCCTGCTGTGCCCCCAGAAGG - Intergenic
938810346 2:134846957-134846979 GCAACTGCTGTTCCCCCACTTGG - Intronic
942135584 2:172921756-172921778 GCCTCTGCTGTGCTCAGACTTGG + Intronic
943125860 2:183792670-183792692 GCCTCTGCCCAGCCACCACCCGG - Intergenic
943851100 2:192724097-192724119 GACTCTGCAGAGTCCCCACCAGG - Intergenic
946165935 2:217863860-217863882 GCAGCTGCTGTGCCCACCCCAGG - Intronic
946692596 2:222320208-222320230 GTCGCTGCTGCGCCCCCGCCTGG - Intergenic
947574353 2:231260893-231260915 CCCCCTCCAGTGCCCCCACCCGG + Intronic
947582571 2:231330660-231330682 GCCCCAGCTGTACCCTCACCAGG - Intronic
947727760 2:232410392-232410414 TCCTCTGCTGTCCCTCCACTGGG + Exonic
947736883 2:232459724-232459746 TCCTCTGCTGTCTCCCCACTAGG + Exonic
948186782 2:236027507-236027529 GCCTCTGCCCTGCCTCCCCCAGG + Intronic
948887524 2:240891617-240891639 GCATCTGCTGCACCCCCTCCAGG + Exonic
949063722 2:241976423-241976445 CTCTCTGCTGTGACCCCACCTGG + Intergenic
1169263473 20:4153918-4153940 GCATCTCCTGTGCCCCAGCCTGG + Intronic
1169975741 20:11325336-11325358 GTCTCTGCTTTGTCCCCACATGG + Intergenic
1171003029 20:21433893-21433915 GCCTCTCCTCTGACCCCAGCTGG - Intergenic
1171771282 20:29325064-29325086 GCCACCGCCCTGCCCCCACCCGG - Intergenic
1172477353 20:35248885-35248907 GTCTCTGCTGCGGCACCACCTGG + Intronic
1172793115 20:37519762-37519784 CTCCCTGCTGTGCCCCCACGTGG + Intronic
1173011868 20:39190348-39190370 GCATGTGCTGTCCCTCCACCAGG - Intergenic
1173113411 20:40217653-40217675 GCTTCCCCAGTGCCCCCACCTGG + Intergenic
1173915906 20:46708879-46708901 GCCTTTGCTGTTCCCCCTGCGGG + Intergenic
1174588721 20:51628335-51628357 GCCTCTGATGTGGCCCCTCCTGG + Intronic
1175269737 20:57725403-57725425 GCCTTTGCTGTTCCCCTGCCTGG + Intergenic
1175732288 20:61362178-61362200 GCACTTGCTGTGCCCCCACCTGG - Intronic
1175977416 20:62718016-62718038 GCACCTGCTGTTCCCCTACCTGG - Intronic
1176249795 20:64115048-64115070 TCCTCAGCTGGGCCCCCTCCTGG - Intergenic
1176990844 21:15494532-15494554 GCCTGTGCTGTCGCACCACCTGG - Intergenic
1179663465 21:42893215-42893237 GCCTCTGCTCCGCCCCCAGCTGG + Intronic
1180316669 22:11282910-11282932 GCCACTGACCTGCCCCCACCCGG - Intergenic
1180618321 22:17143322-17143344 GCCTGTTCTGTGGCCCCACCTGG - Intronic
1180715473 22:17869060-17869082 GGCTCTGCTGTGTCCTCTCCTGG - Intronic
1180737299 22:18026865-18026887 ACATCTGTTGTGCCCTCACCTGG + Intergenic
1181130177 22:20726618-20726640 GCTTCTGCTCTGCCCACAGCAGG + Intronic
1181315765 22:21970128-21970150 GCCTCTACTGGTCCCCCTCCGGG - Intronic
1181530316 22:23513605-23513627 GCTTCTGCTGTGCCCCCGTCAGG - Intergenic
1181630532 22:24148819-24148841 GCCTCCGCTGGGCTCACACCCGG - Intronic
1181811531 22:25406119-25406141 GCCCCTTCTGTGCCCCTTCCAGG - Intergenic
1183161255 22:36114845-36114867 GCCTCAGCAAGGCCCCCACCTGG + Intergenic
1183443737 22:37838972-37838994 GCCTATGCTATGCTCCCAGCAGG + Intronic
1183706248 22:39476427-39476449 GCTTCTGCTGTGCCCACCCATGG - Intronic
1184119614 22:42441348-42441370 CCCTCTGCTGTGCCCCTTCTGGG + Intergenic
1184187035 22:42871830-42871852 GCCTCTTCTGTCCCCTCCCCAGG + Intronic
1184231955 22:43163132-43163154 GCCCCACCTGAGCCCCCACCCGG + Exonic
1184425775 22:44408498-44408520 GCCTCAGCTCTGCCCTCAGCAGG + Intergenic
1184593801 22:45502680-45502702 GCCCCCTCTGTGCCCCCTCCGGG + Intronic
1184650735 22:45918462-45918484 GCCTCTGCCCTGCTGCCACCGGG - Intergenic
1184681532 22:46074797-46074819 GCCTGTGCTGGGGCCTCACCAGG + Intronic
1184740078 22:46422970-46422992 GCCTCTGCAATGCCACCTCCTGG + Intronic
1185219769 22:49623486-49623508 GCCTCTGCTGTGCCCCGTCCTGG + Intronic
949892812 3:8745870-8745892 GCCACCGCTGTTGCCCCACCTGG - Exonic
950006664 3:9695875-9695897 GCCTGCCCTGTGCCCCCTCCAGG - Intronic
950312457 3:11970358-11970380 GTCCCTGCTCTGTCCCCACCTGG - Intergenic
950554244 3:13685705-13685727 GCCTGTGCTGAGCCCGCTCCAGG - Intergenic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
953846519 3:46431576-46431598 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
954291480 3:49652284-49652306 GCCTCTGCTGAGCCTCCCTCAGG - Exonic
954752724 3:52822861-52822883 GTCTCTGCTGGGCCTCCTCCAGG + Intronic
956780254 3:72597828-72597850 GCCTGTGCTGTCCTCCCACGGGG + Intergenic
956857180 3:73286727-73286749 GCCTCTACTCTGCCCTCATCTGG + Intergenic
957084280 3:75665768-75665790 GGATCTGCTGTGCCCACACCTGG - Exonic
957217818 3:77344507-77344529 GTTTCTGCTGTGTCCTCACCTGG - Intronic
958117529 3:89240074-89240096 GCCCCTGCTTTGGCCCCACTGGG - Intronic
958424336 3:93963947-93963969 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
958497504 3:94864019-94864041 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
958819884 3:98961265-98961287 CCCTTTGCTGTTCTCCCACCTGG + Intergenic
959699191 3:109282363-109282385 GCTTCTGGTGTGGCCTCACCAGG + Intergenic
961468806 3:127098394-127098416 GCCTCTTCTGTGGGCCCAGCAGG + Intergenic
961591816 3:127986905-127986927 GCCTCTGCTGAGCTGCCACAGGG - Exonic
961652850 3:128425920-128425942 GCACCTGCTGGGCCCCCGCCTGG - Intergenic
961658499 3:128456224-128456246 GCCTGTGCCTTGCACCCACCAGG - Intergenic
961823468 3:129586897-129586919 GCCTCTGCTGTGCCCCCACCAGG + Intronic
962245300 3:133785678-133785700 GCCTCTGCCCAGCCACCACCCGG + Intronic
962381255 3:134899864-134899886 ACCCTTGCTGTGCCCCCACCTGG - Intronic
965341009 3:167491189-167491211 GACTCTGCTTTGCCCCACCCGGG + Intronic
965559323 3:170046440-170046462 GCCTCAGCTATGCCACCGCCTGG + Intronic
966505151 3:180692432-180692454 GCCCCTGCTGCCCTCCCACCTGG - Intronic
967219108 3:187234502-187234524 GTCCCTGCTCTGCCCCCAACTGG - Exonic
968185910 3:196633589-196633611 GCCTGTGCTGAGCCCCTACAAGG + Intergenic
968356494 3:198111616-198111638 GGACCTGCTGTGCCCACACCTGG - Intergenic
968467927 4:762296-762318 TCCTCTGCTCTGTCCTCACCAGG - Intronic
968576303 4:1367815-1367837 GCCCCAGCTGTGCCCTCATCGGG + Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
968691484 4:1992498-1992520 GCCTCTGCCATGCGCCCACTGGG + Intronic
968887117 4:3341037-3341059 GCCACCACTGGGCCCCCACCAGG - Intronic
969462450 4:7335946-7335968 GTCTCAGCTCTGCCCCCTCCTGG + Intronic
970894251 4:21084071-21084093 GCTTCTGCTGTGGCTCCAGCAGG + Intronic
972647221 4:40980506-40980528 GGCTCTGCAGTGCCCCCTCGTGG - Intronic
973274296 4:48292174-48292196 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
973659159 4:53084633-53084655 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
974070313 4:57117557-57117579 GCCTCTGCAGTGCAGCTACCTGG + Intergenic
974597786 4:64037047-64037069 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
976105788 4:81615577-81615599 TCCTCAGCTGGGCCCCCACTTGG + Intronic
977323655 4:95549098-95549120 GCGACTGCTCTGCCCCCACTTGG + Exonic
978052825 4:104223494-104223516 GCCAGTTCTGTGACCCCACCAGG + Intergenic
978206845 4:106090006-106090028 GCCCCTGCAGAGTCCCCACCAGG - Intronic
979484316 4:121253679-121253701 GCTTCTTCTCTGTCCCCACCAGG - Intergenic
981970858 4:150660534-150660556 GCCTCTGCCCAGCCACCACCCGG + Intronic
983216673 4:165008390-165008412 GCCTCTGCTCTCACCCCACCAGG + Intergenic
983303471 4:165956831-165956853 TCCTCTGCTGTGGCTCCAGCCGG + Intronic
985362441 4:189190026-189190048 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
985446708 4:190025803-190025825 GGATCTGCTGTGCCCACACCTGG + Exonic
985968546 5:3356323-3356345 GCCTCTGCCATGCTCCCACCTGG - Intergenic
986146686 5:5084424-5084446 GCCTCTTCTATGCCCTCTCCAGG + Intergenic
986242755 5:5976297-5976319 GCCTCTGCTCTGAGCCCTCCAGG + Intergenic
987229547 5:15879345-15879367 GCCTCTGCTTGCCCTCCACCAGG + Intronic
989733868 5:44679428-44679450 GCCTCTACTGGGCCCCAGCCTGG + Intergenic
990704514 5:58513444-58513466 TCCTCTGCTGTGGCTCCAACCGG - Intergenic
991264045 5:64696039-64696061 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
991456653 5:66811119-66811141 GCCTCTCCTGTGCGGCCACCTGG + Intronic
992942040 5:81772108-81772130 GCATCTGCTGTCCTACCACCTGG - Intergenic
993062019 5:83050016-83050038 ACCTCTGCAGTGCCCACCCCAGG - Intergenic
993457689 5:88144284-88144306 GCCTCTGAGGTGCCCCACCCCGG + Intergenic
995187466 5:109287269-109287291 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
995768109 5:115640550-115640572 GCCTCTGCTGCAGCCTCACCTGG + Intergenic
995857947 5:116613643-116613665 GCCTCTGCTGTGCTTCTAACAGG - Intergenic
997764404 5:136485761-136485783 GCATCTGCTGTTCCTCCACCTGG + Intergenic
998093249 5:139382996-139383018 GCCTCTCCTGAACCCCAACCTGG + Intronic
998217144 5:140245911-140245933 GACACTCCTCTGCCCCCACCAGG + Exonic
999105829 5:149070113-149070135 CCCTGTGCTGTGCCCCCAGGAGG - Intergenic
999179056 5:149655969-149655991 ACCTCTGCATTGCCCACACCAGG - Intergenic
999261708 5:150242567-150242589 GCCTGTGATGTGGCTCCACCAGG + Intronic
999812160 5:155137999-155138021 TCCCTTGCTGTGCTCCCACCTGG - Intergenic
1001456268 5:171862690-171862712 GCTGCTGCTGTGGCCCCAGCAGG - Exonic
1002416027 5:179121439-179121461 GCCTCTGCTGGGGCCGAACCTGG - Intronic
1002518163 5:179774538-179774560 TCCTCTGCTGTGCACTCACTGGG - Exonic
1002534659 5:179869657-179869679 GACGCTGCTGTGCCCCCTCGAGG + Intronic
1002549983 5:179980961-179980983 GCCTCCTCTGTGCTGCCACCTGG - Intronic
1002906637 6:1454414-1454436 GCCTCTTCTGTGCCCTCTCCAGG + Intergenic
1003181989 6:3799874-3799896 CCCTCTCCAGTGCCCCCAGCTGG - Intergenic
1004286073 6:14322167-14322189 CCCTCTGCTGGGCGCCCACATGG - Intergenic
1004894604 6:20135693-20135715 GCCTCTGATGTTCTCCCAACAGG + Intronic
1005327913 6:24720410-24720432 GCCGCCGCTCAGCCCCCACCTGG + Exonic
1006105018 6:31711247-31711269 GCCTGTGCTCAGCTCCCACCCGG + Intronic
1006444213 6:34069801-34069823 GCCACGTCTGTGCCCCCAACAGG + Intronic
1006448866 6:34094679-34094701 GCCTCTGCTGGGCCCTAGCCAGG + Intronic
1006725519 6:36196830-36196852 GCCTCCGCCGTGCCCCCTCCCGG - Exonic
1007286249 6:40749533-40749555 GCCTCTGCTGTTCCCCTACTTGG + Intergenic
1008960564 6:57261678-57261700 CCATTGGCTGTGCCCCCACCTGG - Intergenic
1010202992 6:73299298-73299320 GCGGCTGCTGTGCCCACCCCCGG - Intronic
1010776455 6:79891721-79891743 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1010816663 6:80365833-80365855 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1012168524 6:95989489-95989511 TCCTCTGCTGTGGCCCTAGCTGG - Intergenic
1013119114 6:107125784-107125806 GCCTCTGCTGTCCACTGACCTGG - Intergenic
1013226841 6:108125303-108125325 GCCTCTGCTGTGCCCGCAGTTGG + Intronic
1015487302 6:133787341-133787363 ACCTGTGCTCTGACCCCACCTGG - Intergenic
1016820677 6:148343164-148343186 GCCTCGGATGTGCCAGCACCCGG - Exonic
1016825898 6:148388243-148388265 GCCTCTGCTGTGCTGCCTCCAGG - Intronic
1017087021 6:150723069-150723091 GCTTGTGCTGTGCCTCCAGCTGG + Intronic
1017363536 6:153604873-153604895 ACCTCAGCTGTACCCCCACAAGG + Intergenic
1017391231 6:153941756-153941778 GCTTCTGCTGTCCTCCCCCCTGG + Intergenic
1017577395 6:155820008-155820030 GCGTCTGTTGTTCCCCCACTGGG - Intergenic
1017774933 6:157673134-157673156 GCCTCTGGTGTCCCCCGGCCTGG - Exonic
1018102209 6:160450759-160450781 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1019116858 6:169772065-169772087 GTCCCTCCTGTGCCACCACCTGG + Intronic
1019169668 6:170125789-170125811 ACCTCAGCTGTGCCTCCACGAGG - Intergenic
1019361752 7:608634-608656 GCCTCCACTGTCCTCCCACCTGG + Intronic
1019361799 7:608764-608786 GCCTCCACTGTCCTCCCACCTGG + Intronic
1019361824 7:608829-608851 GCCTCCACTGTCCTCCCACCTGG + Intronic
1019361848 7:608894-608916 GCCTCCACTGTCCTCCCACCTGG + Intronic
1019361873 7:608959-608981 GCCTCCACTGTCCTCCCACCTGG + Intronic
1019361898 7:609024-609046 GCCTCCACTGTCCTCCCACCTGG + Intronic
1019388220 7:770634-770656 GCCTCTGCACGGCCCCCAGCTGG + Intronic
1019568655 7:1697472-1697494 GCCTCGGCTGTGCCGGGACCTGG - Intronic
1019631761 7:2053297-2053319 CCCTGTGCTCTGCCCCCGCCCGG - Intronic
1019652587 7:2168493-2168515 GCCTGGGCTGTGGCCCCAGCTGG + Intronic
1019982237 7:4630102-4630124 GCCTCCTCTCTGCACCCACCCGG - Intergenic
1020088553 7:5324487-5324509 GCCTCTGGGGTGCCCCTAACTGG - Intronic
1021176858 7:17459536-17459558 ACCTCTGCTGTGGCTCCAGCCGG + Intergenic
1021574603 7:22095788-22095810 GCCTCTGCTGTCTCCCCTCTTGG - Intergenic
1023287715 7:38636679-38636701 GCAGCTCCTGTGCCCTCACCCGG + Intergenic
1023994886 7:45153328-45153350 CCCTCTGCCCTGCTCCCACCAGG - Intergenic
1024582761 7:50813299-50813321 GCTTCTGCTCTGCTCCCTCCAGG + Intergenic
1025021157 7:55481232-55481254 GCCTCTCCTGTGGCCCCTCCTGG - Intronic
1025205757 7:56992627-56992649 GCCTCTGGGGTGCCCCTAACTGG + Intergenic
1025666183 7:63584311-63584333 GCCTCTGGGGTGCCCCTAACTGG - Intergenic
1027056902 7:75055856-75055878 ACCTCTGCTGGGCTCACACCAGG + Intronic
1029157261 7:98526111-98526133 GCCTGTGCTCAGGCCCCACCAGG - Intergenic
1029490135 7:100866377-100866399 GCCCCTGCTGGGCCCGAACCAGG - Exonic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1032696095 7:134337667-134337689 GACTCTGCTGAGACCCCACCTGG + Intergenic
1033673017 7:143511286-143511308 GCCTCTGCTGGGCGCCTGCCTGG - Intergenic
1033993029 7:147311379-147311401 GCCTCAGCTGTGCAACCATCTGG - Intronic
1034276472 7:149826090-149826112 GTCCCTGGTGTGCCCACACCAGG + Intergenic
1034990603 7:155545529-155545551 GCCTCTTCTGGGCCCCCTGCTGG + Intergenic
1035165243 7:156985530-156985552 CCGTCTGCTGTTCCCACACCAGG - Intergenic
1035262043 7:157668114-157668136 TCCTCTGCTGTGCCCAGGCCGGG + Intronic
1035478228 7:159158847-159158869 GCCTCAGCTGTGCCAGCACCCGG - Intergenic
1035601887 8:902060-902082 CCCTCTGCGGTGGACCCACCAGG - Intergenic
1035633276 8:1124966-1124988 GCACCTGCTCTGCCCCCACACGG + Intergenic
1037387785 8:18361896-18361918 GCATCTGCAGTGCCACCTCCTGG - Intergenic
1037769961 8:21792730-21792752 GCCTCTGCTGTTTGCTCACCTGG - Intronic
1038304304 8:26384668-26384690 ACCTCTGCTTTGCTCCCAGCCGG - Intronic
1040603894 8:48910836-48910858 CGCTCTGCAGGGCCCCCACCCGG - Intergenic
1040834678 8:51719121-51719143 CCCTCTGCCCTGCCGCCACCCGG + Intronic
1040926351 8:52687947-52687969 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1041244852 8:55880162-55880184 GCCGCGGCTGTGCCACCAGCCGG + Intronic
1042191440 8:66191632-66191654 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1042478343 8:69275507-69275529 GGCTCTGCTGTTTCCCAACCAGG + Intergenic
1042505653 8:69556947-69556969 GCGTGTGCTGTTCCCCCACATGG + Intronic
1048329966 8:133464683-133464705 GGTCCTGCTGTGCCTCCACCGGG - Intronic
1048444112 8:134480618-134480640 GCCTCTCCTGGGACCCCAACTGG - Intronic
1048727251 8:137400567-137400589 GCCTCTCCTGGGGCCCCAGCTGG + Intergenic
1049104579 8:140603919-140603941 GCTTCTGCTGTGCCCTCTGCTGG + Intronic
1049164453 8:141117636-141117658 GCCTCTGCCCTGCCTCCACCTGG + Intronic
1049192978 8:141298984-141299006 CCCTCACCAGTGCCCCCACCAGG + Intronic
1049253946 8:141604121-141604143 GCCTCTGCTGGGCCCCAAGAGGG + Intergenic
1049453203 8:142673722-142673744 GCCGGTCCTGTGGCCCCACCTGG - Intronic
1049509732 8:143021485-143021507 GCCTCTGCTGAGCCCCGGCCCGG - Intronic
1049644401 8:143729578-143729600 GCCCTTGCCGTGCCCCAACCTGG - Intronic
1049658120 8:143807831-143807853 GTCCCTGCTGTGGCCCCTCCGGG + Intronic
1049820466 8:144630174-144630196 GCCCCAGCTAGGCCCCCACCCGG + Intergenic
1051401164 9:16684403-16684425 AGCTCTGCTGTGCCCCAAACTGG - Intronic
1052259091 9:26492707-26492729 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
1052259137 9:26492863-26492885 GCCTCTGCCTGGCCGCCACCTGG + Intergenic
1053073161 9:35112823-35112845 GCCTGTGCTGTGGACCCCCCAGG + Intronic
1053749201 9:41235780-41235802 GGCTCTGCTTTGCCCCGCCCTGG + Intergenic
1054254638 9:62800633-62800655 GGCTCTGCTTTGCCCCGCCCTGG + Intergenic
1054336662 9:63814969-63814991 GGCTCTGCTTTGCCCCGCCCTGG - Intergenic
1054798972 9:69327706-69327728 TCCTCTGGTGTGCCCAGACCTGG - Intronic
1056576122 9:87857343-87857365 GCCTCTGCCCTGCCCCCGCAAGG - Intergenic
1056634186 9:88318151-88318173 GCTTCTGCTGTCCCCCAGCCCGG + Intergenic
1057171653 9:92966542-92966564 GAGTCTGCGGTGCCCCCACCTGG - Intronic
1057613490 9:96567372-96567394 GCCCCTGCAGTGCGCCCTCCCGG + Intronic
1057829430 9:98395548-98395570 GTCTCTGCTCTGCCCACCCCAGG - Intronic
1059393492 9:114016275-114016297 CCCTCTGCAGTGGCCACACCCGG - Intronic
1059422253 9:114199521-114199543 GCTTCTGCTGTGCCCTCCCCAGG + Intronic
1059656578 9:116362981-116363003 GAGTCTTCTGTGTCCCCACCAGG - Intronic
1060850366 9:126869680-126869702 GCCTCTGCCGTGACCACACAAGG - Intronic
1060854570 9:126904926-126904948 GCCTCTGCCGAGCCCCCAGTAGG + Intergenic
1060927877 9:127467899-127467921 GTCTCTGCTGTTCCCCAGCCTGG - Intronic
1060931056 9:127489822-127489844 GCCTCTGCTGTCCCTGCTCCAGG + Intronic
1061064598 9:128269536-128269558 GCCTCTCCCTTGCCCCCAACTGG + Intronic
1061250034 9:129421197-129421219 GCTCCTGCTGTGCCCCCGCCAGG + Intergenic
1061289254 9:129641596-129641618 GCCTGTCCTGTGCCACCCCCCGG - Intronic
1061534346 9:131238496-131238518 GCCTCTGCCCAGCCCCCGCCGGG - Intergenic
1061809655 9:133154935-133154957 GCTCCTGCTGTCCCCTCACCTGG + Intronic
1061938531 9:133871882-133871904 GCCCCTTCTGAGCCCCCAGCAGG + Intronic
1062142276 9:134966146-134966168 GGCTCTGCTGTGCCCCATGCTGG - Intergenic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1062629102 9:137455694-137455716 GCCTCCCCTCAGCCCCCACCCGG + Intronic
1186448846 X:9655293-9655315 GTCTCTCCTGTGCCCCTGCCTGG + Intronic
1187588859 X:20693555-20693577 GCCTATTCTGGGCCCCCACCTGG + Intergenic
1190131033 X:47749084-47749106 CCCTCCACTGTGCCCCCATCAGG - Intergenic
1190170777 X:48110058-48110080 ACCACTGCTCTGCCCCCTCCAGG - Intergenic
1190176914 X:48158024-48158046 GCCACTGCTCTGCCCCCTCCAGG - Intergenic
1190188656 X:48257320-48257342 ACCACTGCTCTGCCCCCTCCAGG - Intronic
1190194376 X:48304747-48304769 GCCACTACTTTGCCCCCTCCAGG + Intergenic
1190203613 X:48384132-48384154 GCCACTACTCTGCCCCCTCCAGG - Intronic
1190206923 X:48411272-48411294 GCCACTACTCTGCCCCCTCCAGG + Intronic
1190248093 X:48704034-48704056 GCTGCTGCTCTGCCCCCTCCTGG - Intronic
1190598262 X:52067082-52067104 GCCTCTGGTGTGCCCCAGACGGG - Exonic
1190610562 X:52186991-52187013 GCCTCTGGTGTGCCCCAGACGGG + Exonic
1190655850 X:52611658-52611680 GCCACTACTATGCCCCCTCCAGG + Intergenic
1190657543 X:52625076-52625098 ACCACTGCTCTGCCCCCTCCAGG - Intergenic
1192230005 X:69257939-69257961 GGCCCTGCGGTGCCCCCATCTGG - Intergenic
1194508229 X:94759941-94759963 GCCTCTTTTATGCCCCCTCCAGG - Intergenic
1198283805 X:135170806-135170828 GCCTGTGCTTTTCCCCCACGTGG - Intronic
1199552166 X:149072306-149072328 ACCTCTGCTGTGCCTTCATCAGG - Intergenic
1200725277 Y:6662640-6662662 TCCTCTGCTGTGGCTCCAGCCGG - Intergenic
1200827660 Y:7660441-7660463 CCCTCCCCTGTGCTCCCACCTGG - Intergenic
1200884469 Y:8254044-8254066 CCCTCTCCTGAGCTCCCACCTGG - Intergenic
1200954073 Y:8927821-8927843 CCCTCTCCTGAGCTCCCACCTGG + Intergenic
1200957902 Y:8970201-8970223 CCCTCTCCTGAGCTCCCACCTGG + Intergenic
1200986413 Y:9306445-9306467 CCCTCTCCTGAGCTCCCACCTGG - Intergenic
1201073748 Y:10171552-10171574 GCCACCGCCCTGCCCCCACCAGG + Intergenic
1202071318 Y:20994411-20994433 GCCTCTGATGTGGCCCTAGCAGG - Intergenic
1202124166 Y:21554457-21554479 CCCTCTCCTGAGCTCCCACCTGG + Intergenic
1202154842 Y:21874923-21874945 CCCTCTCCTGAGCTCCCACCTGG - Intergenic
1202232189 Y:22669204-22669226 CCCTCTCCTGAGCTCCCACCTGG + Intergenic
1202310967 Y:23526954-23526976 CCCTCTCCTGAGCTCCCACCTGG - Intergenic
1202559835 Y:26143640-26143662 CCCTCTCCTGAGCTCCCACCTGG + Intergenic