ID: 961826240

View in Genome Browser
Species Human (GRCh38)
Location 3:129600624-129600646
Sequence CTGGAGAAACAGATAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961826240 Original CRISPR CTGGAGAAACAGATAGGGCT TGG (reversed) Intronic
900027696 1:292289-292311 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900041651 1:471731-471753 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900063086 1:706708-706730 CTGGACAAACAGAGTGTGCTGGG - Intergenic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
904598625 1:31661950-31661972 CTGGGGAATCTGAAAGGGCTGGG - Intronic
906143854 1:43548762-43548784 CTGGAGAGACAGATATCCCTGGG - Intronic
906298705 1:44665259-44665281 GTGGAGAGACAGATAGGGAGGGG + Intronic
906484180 1:46221810-46221832 CTGGAGAAACTGAAAAGGCATGG - Intergenic
906518800 1:46455491-46455513 ATGGAGTAACAGACTGGGCTTGG + Intergenic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
911651029 1:100388776-100388798 CAGGAGAATCACTTAGGGCTGGG - Intronic
911707088 1:101026138-101026160 CTCCAGAAACAGGGAGGGCTGGG + Intergenic
912012736 1:104989523-104989545 CTAGAGAAACATATAAGGCCTGG + Intergenic
912919172 1:113849019-113849041 CTGGAAAAAGAGATAGTGGTTGG + Intronic
913441208 1:118899704-118899726 CTGAAGATAAAGAAAGGGCTTGG + Intronic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915626649 1:157117975-157117997 CTGGAGAAACACTTAAGGTTGGG + Intergenic
918289064 1:183088771-183088793 CTGGAAAGATGGATAGGGCTTGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920505909 1:206515223-206515245 CTAGAGAATCAGCCAGGGCTGGG + Intronic
920938544 1:210458700-210458722 CAGGAAAAATAGATTGGGCTTGG + Intronic
922260029 1:223931733-223931755 CTGGACAAACAGAGTGTGCTGGG - Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
924341194 1:243034293-243034315 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1064351459 10:14581277-14581299 CTGGAGAAACACAGAGGCCCTGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065150833 10:22821559-22821581 CTGGACACACAGAAAGTGCTTGG + Intergenic
1065231528 10:23603537-23603559 ATAGAAAAACAAATAGGGCTAGG + Intergenic
1066162552 10:32749118-32749140 CTGGAGAAACAGGTAAAGATAGG - Intronic
1066226926 10:33392874-33392896 AGGTAGAATCAGATAGGGCTGGG + Intergenic
1066760008 10:38741142-38741164 CTGGTCAAACACATAGGGCATGG + Intergenic
1067173950 10:43929541-43929563 CTGGAGACTCTGATAGGCCTGGG - Intergenic
1067237896 10:44467154-44467176 CTGCAGAAAGAGAGAGGACTGGG + Intergenic
1067327361 10:45281992-45282014 CTGGAAAGACAGAAAGGACTGGG + Intergenic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1067721442 10:48730514-48730536 CTGGAGGAAAAGGTAGGGGTGGG + Intronic
1068344074 10:55747975-55747997 ATGGAAAAACAGATAGGGCACGG - Intergenic
1068853132 10:61767760-61767782 GTGGAGAGACAGAGAAGGCTCGG - Intergenic
1070259037 10:74835568-74835590 CTGGAGAGACAGAAAGAGTTTGG + Intronic
1070688238 10:78505668-78505690 CTGGAGAAGGAGACAGGGCAGGG + Intergenic
1070770938 10:79082039-79082061 GTGGAGTAACAGGCAGGGCTGGG - Intronic
1071500248 10:86198332-86198354 TTGGGGAAACAGAGAGAGCTTGG - Intronic
1072009378 10:91290277-91290299 CTGCAGAAAGAGGTAGGGCCGGG + Intergenic
1072250551 10:93578995-93579017 CTTGAGAAAAAGATGGGGGTGGG - Intronic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1075912203 10:126134302-126134324 TTGGAGAGACAGACAGGGTTGGG + Intronic
1076290773 10:129343710-129343732 CTGGAGAGTCAAAAAGGGCTTGG + Intergenic
1076967926 11:107959-107981 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1080206410 11:29734640-29734662 TTGGGGGAACAGATAGTGCTTGG + Intergenic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1082122301 11:48392203-48392225 GTGGAGAAAGAGATAGAGGTAGG - Intergenic
1083821167 11:65172223-65172245 CTGCAGAGACAGATCGGGGTGGG - Intronic
1084179839 11:67440766-67440788 ATGCAGAAGCAGAGAGGGCTGGG + Intronic
1084859169 11:72006998-72007020 CTGAAGAAAAAGGCAGGGCTAGG - Intronic
1086013641 11:82137502-82137524 CTGGAGCCAAAGAAAGGGCTGGG + Intergenic
1088832719 11:113551145-113551167 CTGGAGGAACAGCCAGGGTTGGG - Intergenic
1088861909 11:113808174-113808196 CAGGAGAAATAAATAGGGGTTGG + Intronic
1090490139 11:127153488-127153510 CAGGAGAAAAAGGTAGGGTTGGG - Intergenic
1092208772 12:6632922-6632944 CTGGAGAAGCAGGCAGGCCTGGG - Intronic
1093251571 12:16811204-16811226 CTGAAGAAGAAGATATGGCTTGG + Intergenic
1093280297 12:17186030-17186052 CTGCAGAAATAGAAATGGCTAGG + Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096212355 12:49776353-49776375 CAGGAGAAACAGATAAGGCCAGG + Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097899033 12:64855414-64855436 TTAGAGAAAGAGATAGGGATAGG - Intronic
1099481040 12:83167059-83167081 GCGGAGAAACTGATAGGGATGGG - Intergenic
1100532371 12:95472540-95472562 TTGGAGAAGTAGATATGGCTGGG + Intergenic
1103056010 12:117820978-117821000 CTTGAGAACCAGACAGGTCTAGG + Intronic
1103096626 12:118137283-118137305 TAAGAGAAACAGATAAGGCTGGG - Intronic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1104280524 12:127372469-127372491 CTGGAAAAACACATGGGACTTGG - Intergenic
1104491094 12:129194192-129194214 ATGGAGAAGCAATTAGGGCTGGG + Intronic
1105555538 13:21444758-21444780 CTGTATAAAAATATAGGGCTGGG + Intronic
1108460136 13:50657534-50657556 CTGGAGAAAGGGATTGTGCTGGG - Intronic
1110290711 13:73803708-73803730 CTGGAGACACAAAGAAGGCTAGG + Intronic
1113128871 13:107012414-107012436 TTGGAGAAATAGCTAGGGCCTGG + Intergenic
1113462823 13:110493707-110493729 CTGGAGACAGTGATAGCGCTTGG + Intronic
1113914198 13:113861230-113861252 CAGGGGAAACAGCCAGGGCTGGG + Intronic
1114280747 14:21191061-21191083 CTGGAGAAAGAATTGGGGCTTGG - Intergenic
1114424052 14:22607714-22607736 CTGGGGAAAGGGCTAGGGCTGGG - Intronic
1114857825 14:26472242-26472264 CTGGAGAAAAAGATAATGGTGGG - Intronic
1116213673 14:41981682-41981704 CTGAAGACACAGATAGGTCATGG - Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1116941145 14:50792133-50792155 CTGGAGAACGAGACAGGCCTGGG + Intronic
1119199819 14:72744033-72744055 CAGGAGAAACACATAGGTCCAGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1120377787 14:83731178-83731200 TTGGAGACACTGATAAGGCTTGG - Intergenic
1120537465 14:85714542-85714564 CTGGAGAGACAGATAGATATTGG + Intergenic
1121467540 14:94125803-94125825 CTGGAGACCCAGATATGGCAGGG - Intergenic
1122104976 14:99446176-99446198 CTGGAGGAACAGCGAGGGTTAGG + Intronic
1122691085 14:103532474-103532496 CTGGAGACCCACACAGGGCTTGG - Intronic
1123124405 14:105935898-105935920 CTGGAGATCCAGATAGGGCATGG + Intergenic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1126878170 15:53066471-53066493 CTGGAGATTCAGATAGGCCTGGG - Intergenic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1128918907 15:71593100-71593122 ATGGACAAAGAGATAAGGCTGGG - Intronic
1129457656 15:75684170-75684192 CTGGTGGAACAGAAAGGGCATGG - Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129726145 15:77902789-77902811 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1129882554 15:79016860-79016882 CTGTAGAAACTGAAAGGGCAGGG - Intronic
1130274201 15:82468152-82468174 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130466546 15:84195526-84195548 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130497718 15:84478010-84478032 CTGGTGGAACAGAAAGGGCATGG - Intergenic
1130588843 15:85200119-85200141 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130936041 15:88471341-88471363 CTAGAAAAGCAGGTAGGGCTGGG + Intronic
1131191244 15:90318672-90318694 CTGGAGAGACAGGCTGGGCTGGG - Intergenic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1134334785 16:13288410-13288432 CTTGAGAAGAAGATAGGGATTGG + Intergenic
1134346814 16:13398963-13398985 CTAGAAATACAGATAGGGCGTGG + Intergenic
1134810911 16:17166346-17166368 CTGGAGGAACAGATGGGAATTGG - Intronic
1134880924 16:17745076-17745098 GTGGAGGAACAAAGAGGGCTCGG - Intergenic
1136569150 16:31086492-31086514 CTGGTGAAAGAGACGGGGCTGGG + Intronic
1137580365 16:49630146-49630168 GTGGAGAGAAAGACAGGGCTGGG + Intronic
1138659737 16:58510000-58510022 CTGGAGGAACAGGTATGTCTTGG - Intronic
1138781549 16:59794595-59794617 TTGGAGAAACTGATAAAGCTGGG + Intergenic
1139130121 16:64132924-64132946 CAGGAGAAACACATTTGGCTTGG + Intergenic
1140043311 16:71423942-71423964 CTGGGGAGACAGAGAAGGCTTGG + Intergenic
1142452754 16:90191180-90191202 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1142702070 17:1668859-1668881 CTGAAGAAACTGAGAGGGATTGG - Intronic
1142995236 17:3756133-3756155 CTGGAGAAACAAGGATGGCTGGG - Intronic
1143283222 17:5770428-5770450 ATGGAGAGAAAGAGAGGGCTGGG + Intergenic
1145758111 17:27407748-27407770 AAGGAGAAACACACAGGGCTAGG + Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1147807764 17:43144315-43144337 CTTGGGAAAAAGACAGGGCTTGG + Intergenic
1148169541 17:45507734-45507756 CTTGGGAAAAAGACAGGGCTTGG + Intergenic
1148365808 17:47054926-47054948 CTTGGGAAAAAGACAGGGCTTGG - Intergenic
1149045955 17:52245956-52245978 CTGGAGAGAAAGAGAGTGCTGGG - Intergenic
1149557612 17:57585306-57585328 GTGGAGATAGAGATTGGGCTAGG + Intronic
1150122746 17:62617386-62617408 CTGGAAAAACAGGCAGGCCTGGG + Intergenic
1150400731 17:64854223-64854245 CTTGGGAAAAAGACAGGGCTTGG + Intergenic
1150654934 17:67033290-67033312 CTGGCGAAACACACAGGGGTGGG - Exonic
1150944574 17:69731157-69731179 TTGGAGAAAGAGAGAAGGCTGGG - Intergenic
1151566274 17:74900319-74900341 AAGGAGAAGCACATAGGGCTTGG + Intergenic
1151752635 17:76049367-76049389 CTTGAAAAACAGATGGGGTTTGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152742004 17:82022568-82022590 CTGCAGAAACAGGCAGGGGTGGG - Intronic
1153388736 18:4531186-4531208 GTGGAGAAATAGGTAGGGCTGGG - Intergenic
1153468297 18:5414766-5414788 CTGGAGAAAGAGAAACTGCTGGG + Intronic
1155387539 18:25295785-25295807 CTGGAGAAACAGGTATGTATGGG - Intronic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1156518445 18:37700713-37700735 CTGTAGCAGCAGGTAGGGCTGGG - Intergenic
1158750189 18:60249798-60249820 GTGCAGAAAAATATAGGGCTGGG - Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1160139789 18:76311239-76311261 CTGGAGAAGCAGACACAGCTCGG - Intergenic
1160192353 18:76724401-76724423 CTGCAGAAAAAGAAACGGCTAGG - Intergenic
1160644731 19:177582-177604 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1163774736 19:19211609-19211631 CTGGAGAATCAGGCAGGGCGAGG + Intergenic
1165073398 19:33268273-33268295 CTGGGGAAACGGCCAGGGCTGGG + Intergenic
1165207255 19:34200561-34200583 ATGGAGAAACAGAGTGGGTTTGG + Intronic
1167389963 19:49188618-49188640 CTGGAGAGACAAAGAGGGCACGG - Intronic
1168082317 19:54019169-54019191 GTGGTAAAACAGAAAGGGCTTGG + Intergenic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
925591588 2:5515246-5515268 CTGTCTAAAAAGATAGGGCTTGG - Intergenic
925805317 2:7642473-7642495 GTGGAGAAACACAGAGGACTTGG + Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
928075117 2:28257385-28257407 CTAGAGAAACAGAAAGTGGTCGG - Intronic
928111809 2:28516706-28516728 CTGGGCACACAGATATGGCTAGG + Intronic
928902011 2:36329638-36329660 CTGGAGAAGAAGAGGGGGCTGGG - Intergenic
929363239 2:41120358-41120380 CTGGTGAAACAGGTAGAGCTAGG + Intergenic
929558966 2:42943723-42943745 CTGGAGAAGTTGATGGGGCTTGG + Intergenic
929775695 2:44929435-44929457 CTGGAAAAACAAACAGGGCGGGG + Intergenic
929837445 2:45418434-45418456 CTGAAGAAAGTGAAAGGGCTGGG - Exonic
930058591 2:47270789-47270811 AAGGAGAAACAAACAGGGCTGGG + Intergenic
930565038 2:53008225-53008247 CTGGAGAAATAGATATGACCGGG + Intergenic
936243175 2:110805706-110805728 CTGGAGAAGCAGCTAAGGGTTGG + Intronic
936441054 2:112553788-112553810 CTGGGGAAAAATACAGGGCTGGG - Intronic
936480527 2:112880765-112880787 CTGGAGAAAAGGTCAGGGCTGGG + Intergenic
937070228 2:119057515-119057537 CTGGAGGAGCAGAGAGGGATGGG + Intergenic
937586992 2:123564840-123564862 AAGAAGAAAAAGATAGGGCTAGG - Intergenic
939267158 2:139889003-139889025 CTAGAGTAAGAGATAGGGCAGGG + Intergenic
939691686 2:145269830-145269852 CTGGAGAAAAGGAAAGGGGTTGG - Intergenic
939705406 2:145446769-145446791 GTGGAGAAAGAGAGAGGTCTAGG - Intergenic
940512096 2:154628583-154628605 GTGGAGAAACAGATAGGAGTAGG - Intergenic
940607228 2:155941571-155941593 CAGGAGAGAGAGAGAGGGCTAGG + Intergenic
940812684 2:158263053-158263075 CTAGAGAGACAGAGAGGGCAAGG - Intronic
941226613 2:162857510-162857532 ATGGAGAAAGAGGTATGGCTTGG - Intergenic
942299335 2:174547017-174547039 CTAGAGAAAGAGATGGGCCTGGG + Intergenic
946179429 2:217940886-217940908 GAGGAGAACCAGAGAGGGCTGGG - Intronic
946411539 2:219517583-219517605 CTGGAATTACAGATTGGGCTGGG + Intronic
946593348 2:221276707-221276729 CTGTTGAAATAGATAGGTCTGGG + Intergenic
946716880 2:222562154-222562176 CTGGAGAGGCAGATAGTCCTGGG - Intergenic
947513050 2:230776639-230776661 CTGGAGAAACAAGTAGGTCATGG + Intronic
949081050 2:242100032-242100054 CTGGTGAAACAGATAGGCAGTGG + Intergenic
1169164278 20:3408295-3408317 CTGCAGAAACCGGTAGAGCTAGG - Intergenic
1169251424 20:4064124-4064146 ATCCAGAAACAGAGAGGGCTTGG + Intergenic
1169887065 20:10411277-10411299 CTAAAAAAACAGAAAGGGCTGGG - Intronic
1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG + Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1172437000 20:34936346-34936368 CTAGAGAAAAGGATAAGGCTTGG + Intronic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1176280777 20:64308329-64308351 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1177438795 21:21090844-21090866 TTTGAGAAACAGATTGGGATAGG - Intronic
1178495126 21:33079773-33079795 CTTGAGAAGCAAATAGGGCCAGG + Intergenic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1182028545 22:27139091-27139113 CTGGAGAAACAGGCAAGGATGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
949483290 3:4513783-4513805 CTGAAGAATCAGATAGACCTAGG + Intronic
950887758 3:16375818-16375840 CTGGAGAAACAGACCCTGCTGGG - Intronic
950969921 3:17176082-17176104 CTGTAGAATCAGACAGAGCTGGG + Intronic
952041466 3:29266785-29266807 CTGGGGAAACAGAAATGGATAGG + Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
954036060 3:47851879-47851901 CTGGAGAACAAGAAAGGGCCAGG - Exonic
954344314 3:49983814-49983836 CAGGAGACACTAATAGGGCTGGG + Intronic
954784874 3:53085254-53085276 CGGGAGAAGCAGAGAGGGCTGGG + Intronic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
960226243 3:115172594-115172616 TTGGAGAAACTCATATGGCTAGG + Intergenic
961032668 3:123620160-123620182 CTGGTGAGAAAGAAAGGGCTGGG - Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
962369138 3:134806284-134806306 CAGGAGAAACAGAGAGAGCTAGG - Intronic
962993399 3:140601106-140601128 CTGGAGATGCAGCTAGTGCTGGG - Intergenic
963380093 3:144518418-144518440 CTGGAGAAAAAGATATTGCAAGG + Intergenic
963801954 3:149685009-149685031 ATGATGAAACAGATAGGGATGGG - Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
967388799 3:188935146-188935168 CTTGAGAAACAGATGAGGTTTGG + Intergenic
967634400 3:191784354-191784376 CTGAAGCAACAGCTTGGGCTTGG + Intergenic
969502137 4:7559587-7559609 CTGGAGCAACAAATGTGGCTGGG + Intronic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
970381105 4:15508707-15508729 CTTGAGGAACAGGTAGGACTTGG + Intronic
971034604 4:22679282-22679304 CTGGAAAGAAAGATAGGACTTGG + Intergenic
971567655 4:28166640-28166662 GTAGAGAACAAGATAGGGCTAGG - Intergenic
972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG + Intronic
973895101 4:55404308-55404330 CTGAAGAAACTAATATGGCTGGG - Intronic
974121349 4:57642715-57642737 CTGGAAAAATCAATAGGGCTAGG - Intergenic
976416977 4:84787840-84787862 GTGGAGAAACAGGAAGGGCAAGG + Intronic
976528863 4:86126889-86126911 CTGGAGGTACAAATAGGCCTTGG - Intronic
977688435 4:99875905-99875927 ATGCAGAAAAAGATAGGTCTTGG + Intergenic
978536780 4:109771009-109771031 CTGGAGAGAGAGTTAGGGGTGGG + Intronic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
983150205 4:164269248-164269270 CTGGACAAACAGAGTGTGCTGGG - Intronic
984571725 4:181403485-181403507 CTGGAGACAGAGAGAGGGCAGGG + Intergenic
984818199 4:183857689-183857711 GAGGAGAAAGAGACAGGGCTGGG - Intronic
985130634 4:186735100-186735122 CTGAAGGTACAGCTAGGGCTGGG - Intergenic
985869405 5:2542368-2542390 GTGGTGGAACAGAAAGGGCTTGG - Intergenic
986764001 5:10906846-10906868 CAGGAGAAACAAGTAAGGCTGGG + Intergenic
987438421 5:17926213-17926235 GGTGAGAAAAAGATAGGGCTGGG - Intergenic
989112378 5:37919005-37919027 TTGGAGAAGCAGATAGTACTGGG - Intergenic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
992578167 5:78141616-78141638 ATGGAGAAACAAATAGGTATGGG - Intronic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
998226390 5:140329958-140329980 CTGGAGAAACAAAGTGTGCTTGG + Intergenic
998253184 5:140566290-140566312 CTGGAGAAACCGGCAGGGCTAGG + Intronic
998307871 5:141096796-141096818 CGGGAGCAGCAGGTAGGGCTGGG - Exonic
998308506 5:141102649-141102671 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998316715 5:141189318-141189340 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998317347 5:141194552-141194574 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998318979 5:141210907-141210929 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998319544 5:141216123-141216145 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
999934660 5:156474038-156474060 CTGGAGAAAATGAAGGGGCTGGG - Intronic
1001014494 5:168127972-168127994 CTGGAGTGAGAGACAGGGCTAGG + Intronic
1001267317 5:170283320-170283342 CTGGAGAAAGTGGTAGGGGTGGG - Intronic
1001937861 5:175718554-175718576 CTGGAGAATCAGATAGTCCTGGG - Intergenic
1002732193 5:181347198-181347220 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1002752342 6:126906-126928 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1005184887 6:23154290-23154312 TTGGAGATAAAGATAGGCCTAGG - Intergenic
1006304390 6:33210303-33210325 CTTAAGAAAAATATAGGGCTGGG + Intronic
1006710644 6:36066566-36066588 CCGAAGAAACAAATAGGGATAGG + Intronic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1006939543 6:37742710-37742732 CTGGAGGAACAGTTACGGCTTGG + Intergenic
1007378441 6:41471609-41471631 CAAGAGAGACAGATAGGGGTGGG + Intergenic
1008050073 6:46891961-46891983 CTGTAGAAACTGATATGGATGGG + Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010309771 6:74371316-74371338 CTGGAGAAAGAGCTAGGACTGGG + Intergenic
1016565390 6:145446597-145446619 CTGGTGAAAAACACAGGGCTAGG - Intergenic
1018740539 6:166725473-166725495 CTGGAGAAAGAGGCTGGGCTGGG - Intronic
1018868637 6:167764585-167764607 CTGGGGAACCAGAGTGGGCTTGG + Intergenic
1019236445 6:170619512-170619534 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019510790 7:1416286-1416308 CTGGATGAATAGATAGGGATAGG + Intergenic
1021658497 7:22895276-22895298 CTAGAGAAGCAGATGGGGTTGGG - Intergenic
1021678122 7:23101598-23101620 CTGGAGGAATAGAGAGGCCTGGG - Intergenic
1022643701 7:32211719-32211741 CTGAAGAAAGAAATAGAGCTGGG + Intronic
1023317493 7:38955000-38955022 CTGGAGGAACAGAAATGGTTAGG + Intergenic
1023353778 7:39347000-39347022 CTTGAGAAGCAGATGGGCCTGGG + Intronic
1023360191 7:39407638-39407660 CTGGGCAAATAGATAAGGCTGGG - Intronic
1024268697 7:47626010-47626032 ATGCAGAAACACATAGCGCTGGG + Intergenic
1024954162 7:54898736-54898758 CTGGAGAAGCAGGTCGTGCTCGG - Intergenic
1026549186 7:71352611-71352633 CTTGAGAGAGAGATAGGGGTTGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1029111154 7:98213605-98213627 CTGGAGCAGGAGACAGGGCTGGG + Intergenic
1031414956 7:121484630-121484652 ATGGAAAAATATATAGGGCTTGG + Intergenic
1032533327 7:132639621-132639643 CTGGGGAACCAGGTAGGGGTGGG - Intronic
1033524366 7:142195888-142195910 CTGGAGTAAGAGAAAGGGGTGGG - Intronic
1034605723 7:152311798-152311820 CTGTAGAATCAAATAAGGCTTGG + Exonic
1034918858 7:155062369-155062391 CTGGAGAAAGAGCTAGGGAAGGG + Intergenic
1035142754 7:156780270-156780292 CTGGACAAAAAGAAAGTGCTTGG + Intronic
1035511325 8:187095-187117 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1035538954 8:416839-416861 CTGGTGAAACAGATAGGCAGTGG + Intronic
1035592755 8:829368-829390 CTTGAGAAACAGAGAGACCTCGG - Intergenic
1037745557 8:21641377-21641399 CTTGAGAACCAGACAGGTCTAGG - Intergenic
1038616360 8:29099157-29099179 GGGGAGAAACAGAGAGGGCGGGG + Exonic
1038753327 8:30316875-30316897 CTGCAGCAACAGATTAGGCTTGG + Intergenic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1039430240 8:37520050-37520072 CTGGAGATACAGTGATGGCTGGG - Intergenic
1039838176 8:41274108-41274130 CTGGAGAACCAGAGAAGCCTTGG - Intronic
1041424417 8:57703964-57703986 CTGGAGCCACAGAGAGGGATGGG - Intergenic
1042474804 8:69235155-69235177 CTGGAGAGGAAGATAGGCCTAGG - Intergenic
1042657747 8:71118895-71118917 CTACAGAAAGAAATAGGGCTTGG - Intergenic
1043079705 8:75750827-75750849 CAGTAGAAACAAAGAGGGCTGGG - Intergenic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1044250225 8:89997707-89997729 ATGGAGGAATGGATAGGGCTAGG - Intronic
1045972459 8:108094435-108094457 CTGGAGGAACAGGGAGGGTTGGG + Intergenic
1047137505 8:122097040-122097062 TAGGAGAACTAGATAGGGCTTGG - Intergenic
1047410663 8:124621843-124621865 CTGGGGAAAGAGATAGGGGCTGG - Intronic
1050330367 9:4539900-4539922 CTGGAGAAAGCGATAGGGACAGG + Intronic
1050759556 9:9050348-9050370 ATGGAGAAAACGATAGGGCATGG + Intronic
1051972034 9:22900091-22900113 ATGGAAAAACATATAGAGCTGGG - Intergenic
1052246754 9:26346365-26346387 CTGCAGAAAAAAAAAGGGCTTGG + Intergenic
1055154581 9:73044594-73044616 ATGGAGAAAGAGAGAGGGCTGGG - Intronic
1056150059 9:83776964-83776986 TTGTAGAGACAGATAGGACTGGG + Intronic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1061196147 9:129108254-129108276 CTGGAGATGCAGGTAGGGATGGG + Intronic
1061329166 9:129881428-129881450 CTGGAGAAACCGCCAGGGCGAGG + Exonic
1061659295 9:132117974-132117996 TTGGACAAAGAGACAGGGCTTGG + Intergenic
1062108348 9:134767915-134767937 CCTGAGAAACACAGAGGGCTGGG + Intronic
1062525347 9:136976026-136976048 CTGTTGGAACAGATAGGGGTGGG - Intergenic
1062756595 9:138299524-138299546 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1186533919 X:10327932-10327954 CTGGAGAATCTGATTGGTCTGGG - Intergenic
1186839545 X:13471401-13471423 CTTGAGAAACAGCAAGGCCTGGG + Intergenic
1188352497 X:29149593-29149615 CTGGAGAAAAAGAGAGGGTTGGG - Intronic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1192402317 X:70848239-70848261 CTGGAGAAATAAGTAGGGCCAGG - Intronic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1194188413 X:90804496-90804518 GTGGAAAAGCAGATAAGGCTTGG + Intergenic
1196027297 X:111054580-111054602 ATGGAGAAACAAAGAGGGCAGGG - Intronic
1196153544 X:112402064-112402086 CTTGAGAGATAGATAGGACTTGG - Intergenic
1198049499 X:132936359-132936381 CTAGAGAAACATATGGGCCTGGG - Intronic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1199494578 X:148438889-148438911 CTGGAGAAACAGGCAGGGTCAGG + Intergenic
1200139899 X:153894941-153894963 CTTGAGAAACAGAGTGGGCCAGG - Intronic
1200535002 Y:4386401-4386423 GTGGAAAAGCAGATAAGGCTTGG + Intergenic
1202383717 Y:24302541-24302563 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1202487066 Y:25367579-25367601 CTGGACAAACAGAGTGTGCTGGG - Intergenic