ID: 961827205

View in Genome Browser
Species Human (GRCh38)
Location 3:129605418-129605440
Sequence AGCAGGCGGTGCGCGCAGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961827199_961827205 4 Left 961827199 3:129605391-129605413 CCACCACGTCGGGCGCCGGTTCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG 0: 1
1: 0
2: 2
3: 10
4: 105
961827192_961827205 29 Left 961827192 3:129605366-129605388 CCCTGCACCACGCTGTCGAGCAC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG 0: 1
1: 0
2: 2
3: 10
4: 105
961827193_961827205 28 Left 961827193 3:129605367-129605389 CCTGCACCACGCTGTCGAGCACC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG 0: 1
1: 0
2: 2
3: 10
4: 105
961827200_961827205 1 Left 961827200 3:129605394-129605416 CCACGTCGGGCGCCGGTTCCACG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG 0: 1
1: 0
2: 2
3: 10
4: 105
961827194_961827205 22 Left 961827194 3:129605373-129605395 CCACGCTGTCGAGCACCGCCACC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG 0: 1
1: 0
2: 2
3: 10
4: 105
961827198_961827205 7 Left 961827198 3:129605388-129605410 CCGCCACCACGTCGGGCGCCGGT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG 0: 1
1: 0
2: 2
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961827205 Original CRISPR AGCAGGCGGTGCGCGCAGCT CGG Exonic
900340370 1:2185947-2185969 AGCAGGAGGTCCGCGCCGCTGGG - Intronic
900487143 1:2928388-2928410 TGCAGGCAGTGTGCTCAGCTCGG + Intergenic
908398270 1:63746184-63746206 TGCAGGCGGTCAGCACAGCTTGG - Intergenic
912576230 1:110674886-110674908 AACAGGCGGTGGGCTCGGCTCGG - Exonic
916660772 1:166920915-166920937 TCCAAGCGGAGCGCGCAGCTCGG - Exonic
919724351 1:200872555-200872577 AGCAGCCGGTGGGTGCAGGTGGG + Intergenic
920039533 1:203086341-203086363 AGCAGGCAGGCCGCCCAGCTAGG - Intergenic
1067847717 10:49736855-49736877 TGCAGGAGGTGGGCGCAGCTGGG - Intronic
1068648267 10:59493229-59493251 AGCAGGTGGTGCATGCAGGTGGG - Intergenic
1074038117 10:109761482-109761504 AGCAGGTGGTGAGTGCAGCCAGG + Intergenic
1074818706 10:117163567-117163589 AGCAGGCGGGGACCCCAGCTCGG - Intergenic
1077413952 11:2415839-2415861 AGCAGGCAGCGTGGGCAGCTCGG + Intronic
1078621760 11:12914870-12914892 GGCAGGCGGTGCTGGGAGCTGGG - Intronic
1078699804 11:13669140-13669162 AGCACGCGGAGCCCGCTGCTCGG - Intronic
1084114100 11:67031816-67031838 AGCAGGCTGTGGGCACAGCCAGG - Intronic
1091239334 11:134042057-134042079 GGCAGGCGGGGAGCGGAGCTCGG + Intergenic
1091277055 11:134359784-134359806 AGCAGGAGGTGAGCTCAGCTAGG - Intronic
1096238176 12:49943706-49943728 AGCAGGAGGGGAGAGCAGCTGGG - Intergenic
1096779744 12:53984995-53985017 GGCAGGCGGAGCGCGCAGAGTGG - Intergenic
1097848437 12:64389387-64389409 AGCAGGCCCTGCGCCCAGTTTGG + Intronic
1100572795 12:95858798-95858820 TGCAGGCGGCGCGCGGACCTTGG - Intergenic
1101376016 12:104172244-104172266 GGCAGGCGGAGGGCGGAGCTAGG + Intergenic
1106340065 13:28819692-28819714 CGCAGGCGGTGGGCGCGGCGCGG - Intergenic
1110810612 13:79807718-79807740 AGCAGGTGCTGAGGGCAGCTCGG + Intergenic
1117339373 14:54780648-54780670 AGGAGGCTGTGGGCCCAGCTGGG - Intronic
1117554416 14:56869866-56869888 AGCAGGAGGTGAGCGGTGCTGGG + Intergenic
1118849298 14:69572279-69572301 AGCGGGCGGAGCGCGCGGCCCGG - Exonic
1121015533 14:90546634-90546656 AGCAGGAGCTGCGTGCTGCTGGG - Intronic
1121472093 14:94164007-94164029 AGGAGGCAGTGCTCACAGCTGGG - Intronic
1121536621 14:94695456-94695478 AGCAGGCTGTGGCCGCAACTGGG - Intergenic
1123006211 14:105325050-105325072 GGCAGGGGGTGCCCACAGCTTGG - Intronic
1202895099 14_GL000194v1_random:2221-2243 AGCTGGCGGTGTGGCCAGCTGGG + Intergenic
1124118306 15:26867527-26867549 AGCAGGCGGGGCGCGCAGCCAGG + Intronic
1124922347 15:34039023-34039045 TGCAGGCGGAGCGAGGAGCTCGG - Exonic
1125956072 15:43792151-43792173 CGCAGGCGGAGCGCTCAGCGTGG - Intronic
1129250066 15:74303770-74303792 AGCAGGCGGTGCTCCCAGCTCGG - Intronic
1131108575 15:89750569-89750591 CGCAGGCGGGTCGCGCGGCTCGG + Exonic
1132326368 15:100973581-100973603 ACCGGGCGGCGAGCGCAGCTCGG - Intronic
1132807659 16:1782509-1782531 GGCCGGCGGAGCGCGCAGCGGGG - Exonic
1133079171 16:3305176-3305198 AGAACGCGGCGCGCGCAGCTGGG + Intronic
1134562758 16:15224864-15224886 AGCAGGGGGTGTGCTGAGCTAGG - Intergenic
1134923296 16:18136497-18136519 AGCAGGGGGTGTGCTGAGCTAGG - Intergenic
1139530015 16:67538175-67538197 GGCAGGCGGAGCCCGCACCTCGG + Intronic
1141461334 16:84180214-84180236 AGCAGGGGCTGCACGCAGCTGGG + Exonic
1141574402 16:84954814-84954836 AGCCGGAGGTCCACGCAGCTTGG - Intergenic
1142503220 17:345631-345653 AGCAGGGTGTGCGTGCAGATGGG - Intronic
1142503228 17:345669-345691 AGCAGGGTGTGCGCGCAGATGGG - Intronic
1142503244 17:345745-345767 AGCAGGGTGTGCACGCAGATGGG - Intronic
1142503261 17:345830-345852 AGCAGGGTGTGCGGGCAGATGGG - Intronic
1142711510 17:1726234-1726256 AGCAGGCGGGGCGGGCGGCGGGG + Exonic
1145979993 17:29005690-29005712 AGCCGGCGGGGCGCGGTGCTTGG + Intronic
1150217257 17:63477498-63477520 CGCAGGCCGTGCGCGCAGCCCGG - Intergenic
1151928105 17:77213512-77213534 AGCAGGTGCTGCGGACAGCTGGG + Intronic
1152542044 17:80981437-80981459 AGCCGGCGGCCCTCGCAGCTGGG - Intergenic
1159359388 18:67381336-67381358 ACCAGTAGGTGCGCTCAGCTGGG + Intergenic
1161950962 19:7467695-7467717 AGCAGCCAGTGTGCGCAGGTTGG + Intronic
1164635410 19:29787822-29787844 AGCAGCCGGTGGGCCCAGCCTGG - Intergenic
1165233848 19:34404798-34404820 CACCGGCGGTGCGCGCAGGTAGG + Exonic
1165466579 19:35978469-35978491 AGCAGGAGGTGCGGCCAGCAGGG - Intergenic
928768006 2:34670961-34670983 AGCAGGTGGTGAACGCAGCCAGG - Intergenic
929454798 2:42058086-42058108 AGCAGGCGGTGGGGGCTGCGTGG + Exonic
931021194 2:58046824-58046846 AGGAGGCGGTGCGCGCGGCCCGG + Intronic
932252676 2:70258247-70258269 ATCTGGCGGAGCACGCAGCTCGG - Exonic
934951269 2:98577157-98577179 GGCAGGCGGGGCGCGCGGCCTGG - Intronic
935896891 2:107747679-107747701 AGCAAGCGCCGCGCGCAGCCCGG + Intergenic
936940310 2:117878023-117878045 AGCAGGTGGTGAGGCCAGCTAGG + Intergenic
941916916 2:170818923-170818945 AGGAGGAGGGGCGCGCAGCCAGG + Intronic
943156636 2:184187731-184187753 AGCAGGAGGTGAGCGCAGAGTGG - Intergenic
946018041 2:216619919-216619941 AGAGGGCTGTGTGCGCAGCTGGG + Intergenic
948206924 2:236167423-236167445 AGTCGGCGGCGCGCGCAGCCGGG - Intronic
948583934 2:239006761-239006783 TGCAGGTGGTGTGGGCAGCTCGG + Intergenic
1171206661 20:23286979-23287001 AGGAGGCTGTGCGCGGAGGTGGG - Intergenic
1174607076 20:51768592-51768614 AGCGGGCGCAGCGCGGAGCTCGG - Exonic
1175164597 20:57034341-57034363 AGCAGGAGGTGGGGGCACCTTGG - Intergenic
1175880652 20:62256797-62256819 GGCAGGCGGGGCTGGCAGCTTGG + Intronic
1176072736 20:63235406-63235428 AGCGGGAGGTGAGGGCAGCTCGG + Intergenic
1176237957 20:64063051-64063073 AGGAGGCTGTGCGCGCCGCGTGG + Intronic
1176614801 21:9018208-9018230 AGCTGGCGGTGTGGCCAGCTGGG + Intergenic
1179417115 21:41207897-41207919 AGCAGCCAGTGCTCTCAGCTGGG + Intronic
1180588369 22:16914169-16914191 AGCAGCCCATGCGGGCAGCTGGG + Intergenic
1184914538 22:47560240-47560262 TGCAGGTGGTGAGCGCTGCTGGG - Intergenic
954148114 3:48644253-48644275 AGCAGGATGTGCGGGCAGCGAGG + Exonic
957907556 3:86577859-86577881 AGCAGGTGGTGAGACCAGCTGGG + Intergenic
961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG + Exonic
965040258 3:163499044-163499066 CGCAGGCGCAGCGCGCAGCCTGG - Intergenic
968135402 3:196216645-196216667 GGCAGGCGGGGCGGGCAGGTGGG - Exonic
968513165 4:1004108-1004130 AGCGGGTGGTGGGCGCACCTGGG - Exonic
968813391 4:2809971-2809993 AGCAGGGGGTGTGTGCAGCGGGG - Intronic
969342616 4:6551713-6551735 AGCAGGGGCTGAGCTCAGCTGGG - Intronic
970195082 4:13544434-13544456 GGCCGGCGGGGCGGGCAGCTGGG + Exonic
971240423 4:24883619-24883641 AGCAGGCGGTGGGCAGAGCAGGG - Intronic
975622395 4:76307474-76307496 AGCAGGAGGCGCCCGCAGTTCGG - Intronic
982868845 4:160550457-160550479 CGCAAGCGCAGCGCGCAGCTCGG + Intergenic
984155822 4:176195295-176195317 AGCAGGCGGGGCGCCCACCGGGG + Intronic
985727310 5:1523262-1523284 GGCAGGCCCTGCGCGCAGCCCGG - Intronic
998130324 5:139648507-139648529 AGCAGGCGGCGCGCATGGCTGGG - Exonic
1002447862 5:179301082-179301104 AGTAGGCGGTTCTTGCAGCTGGG - Intronic
1005816010 6:29553511-29553533 AGCCAGCGATGCGCACAGCTGGG - Intergenic
1005816048 6:29553714-29553736 AGCAGGCGGGGCGCGCACAGCGG - Intergenic
1005881637 6:30066976-30066998 AGCAGGAGGGGCGCCCAGATGGG - Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1016936709 6:149453322-149453344 AGCAGGTCTTGCGCGAAGCTCGG - Intronic
1019273026 7:161177-161199 AGCAGGCGGTGTGCTCACCTGGG + Intergenic
1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG + Intronic
1021411294 7:20331664-20331686 AGCAGGCGGACCCCGCGGCTCGG - Exonic
1024250522 7:47502574-47502596 AGCAGGCGATGAGGGCAGCAGGG + Intronic
1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG + Exonic
1032268042 7:130381951-130381973 AGCAGGCGCTGCGCACACCCAGG - Intronic
1034474073 7:151272830-151272852 GGCAGGCGGTGGCCTCAGCTTGG + Intronic
1037928807 8:22865401-22865423 CGCAGGTGGAGCGCGCAGCCAGG - Intronic
1039996783 8:42541383-42541405 GGGAGGCGGCGCGCGCAGCCCGG + Intronic
1048322107 8:133407979-133408001 GGGAGGCGGTGGGCGAAGCTGGG - Intergenic
1058618781 9:106862466-106862488 AGAAGGCGGTGCGAGGAGCGCGG - Intergenic
1060524764 9:124314220-124314242 AGCAGGAGGGGCGTGCAGCAAGG - Intronic
1061015321 9:127977992-127978014 AGAAGGCTGTGCTCACAGCTAGG - Intronic
1062532354 9:137007512-137007534 AGCGGGCTGTGGGCGGAGCTGGG - Exonic
1185621334 X:1452884-1452906 AGCCCGCGGTGCGCGCAGCGCGG + Intronic
1195708640 X:107756917-107756939 AGCACGTGGTGCCCCCAGCTGGG + Intronic