ID: 961829455

View in Genome Browser
Species Human (GRCh38)
Location 3:129615991-129616013
Sequence CACAGGGGCTCCACTGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961829445_961829455 -3 Left 961829445 3:129615971-129615993 CCACCAGCCCAGCCTCTGGGCAC No data
Right 961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG No data
961829442_961829455 1 Left 961829442 3:129615967-129615989 CCAACCACCAGCCCAGCCTCTGG No data
Right 961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG No data
961829446_961829455 -6 Left 961829446 3:129615974-129615996 CCAGCCCAGCCTCTGGGCACAGG No data
Right 961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG No data
961829441_961829455 2 Left 961829441 3:129615966-129615988 CCCAACCACCAGCCCAGCCTCTG No data
Right 961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG No data
961829450_961829455 -10 Left 961829450 3:129615978-129616000 CCCAGCCTCTGGGCACAGGGGCT No data
Right 961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961829455 Original CRISPR CACAGGGGCTCCACTGGGTG CGG Intergenic
No off target data available for this crispr