ID: 961829476

View in Genome Browser
Species Human (GRCh38)
Location 3:129616082-129616104
Sequence CAGGCTGATGGCTCTGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961829465_961829476 28 Left 961829465 3:129616031-129616053 CCACAGGGATTGTTTATCTGTGC No data
Right 961829476 3:129616082-129616104 CAGGCTGATGGCTCTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961829476 Original CRISPR CAGGCTGATGGCTCTGAAGG GGG Intergenic
No off target data available for this crispr