ID: 961830683

View in Genome Browser
Species Human (GRCh38)
Location 3:129621568-129621590
Sequence ACAGTGGCACAGAAGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961830683_961830685 -9 Left 961830683 3:129621568-129621590 CCACACTCCTTCTGTGCCACTGT No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961830683 Original CRISPR ACAGTGGCACAGAAGGAGTG TGG (reversed) Intergenic
No off target data available for this crispr