ID: 961830685

View in Genome Browser
Species Human (GRCh38)
Location 3:129621582-129621604
Sequence TGCCACTGTCCCCCACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961830678_961830685 9 Left 961830678 3:129621550-129621572 CCCTGTGGGCTGTCCCACCCACA No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830676_961830685 19 Left 961830676 3:129621540-129621562 CCGAGTCCAGCCCTGTGGGCTGT No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830673_961830685 29 Left 961830673 3:129621530-129621552 CCAGAATCATCCGAGTCCAGCCC No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830681_961830685 -5 Left 961830681 3:129621564-129621586 CCACCCACACTCCTTCTGTGCCA No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830682_961830685 -8 Left 961830682 3:129621567-129621589 CCCACACTCCTTCTGTGCCACTG No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830677_961830685 13 Left 961830677 3:129621546-129621568 CCAGCCCTGTGGGCTGTCCCACC No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830680_961830685 -4 Left 961830680 3:129621563-129621585 CCCACCCACACTCCTTCTGTGCC No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830683_961830685 -9 Left 961830683 3:129621568-129621590 CCACACTCCTTCTGTGCCACTGT No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data
961830679_961830685 8 Left 961830679 3:129621551-129621573 CCTGTGGGCTGTCCCACCCACAC No data
Right 961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961830685 Original CRISPR TGCCACTGTCCCCCACCCCC TGG Intergenic
No off target data available for this crispr