ID: 961831724

View in Genome Browser
Species Human (GRCh38)
Location 3:129626613-129626635
Sequence GACTTCACATTTGAGATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961831720_961831724 27 Left 961831720 3:129626563-129626585 CCATGTCTTGTTCAGAGCATTTA No data
Right 961831724 3:129626613-129626635 GACTTCACATTTGAGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961831724 Original CRISPR GACTTCACATTTGAGATCTG AGG Intergenic
No off target data available for this crispr