ID: 961832407

View in Genome Browser
Species Human (GRCh38)
Location 3:129630534-129630556
Sequence TCTACTATGGAGAAGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961832404_961832407 1 Left 961832404 3:129630510-129630532 CCATTTTGGTTTACACGCATAGT No data
Right 961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961832407 Original CRISPR TCTACTATGGAGAAGTAGGA TGG Intergenic
No off target data available for this crispr