ID: 961833612

View in Genome Browser
Species Human (GRCh38)
Location 3:129638736-129638758
Sequence CCTTTCACTTACTGTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961833612_961833619 -9 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833619 3:129638750-129638772 AGTGAAAGGCAGTTGTTGGGGGG No data
961833612_961833623 10 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833623 3:129638769-129638791 GGGGAAATGAAGGGCTTTCAGGG No data
961833612_961833624 14 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833624 3:129638773-129638795 AAATGAAGGGCTTTCAGGGCAGG No data
961833612_961833620 0 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833620 3:129638759-129638781 CAGTTGTTGGGGGGAAATGAAGG No data
961833612_961833622 9 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833622 3:129638768-129638790 GGGGGAAATGAAGGGCTTTCAGG No data
961833612_961833621 1 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833621 3:129638760-129638782 AGTTGTTGGGGGGAAATGAAGGG No data
961833612_961833618 -10 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833618 3:129638749-129638771 AAGTGAAAGGCAGTTGTTGGGGG No data
961833612_961833625 22 Left 961833612 3:129638736-129638758 CCCAGCTCACAGTAAGTGAAAGG No data
Right 961833625 3:129638781-129638803 GGCTTTCAGGGCAGGCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961833612 Original CRISPR CCTTTCACTTACTGTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr