ID: 961839729

View in Genome Browser
Species Human (GRCh38)
Location 3:129698999-129699021
Sequence AACTATCCAGATATGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961839726_961839729 10 Left 961839726 3:129698966-129698988 CCCAGACTGAGAAAATCTGTTCT 0: 1
1: 0
2: 7
3: 96
4: 595
Right 961839729 3:129698999-129699021 AACTATCCAGATATGTAGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 113
961839727_961839729 9 Left 961839727 3:129698967-129698989 CCAGACTGAGAAAATCTGTTCTT 0: 1
1: 0
2: 1
3: 29
4: 329
Right 961839729 3:129698999-129699021 AACTATCCAGATATGTAGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961839729 Original CRISPR AACTATCCAGATATGTAGCA GGG Intronic
900071943 1:778234-778256 AACTATCCAGGTGTGCAACAGGG - Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
905367545 1:37461987-37462009 AACTGTGCAAATACGTAGCAGGG - Intergenic
907691138 1:56667797-56667819 TATAATCCAGATTTGTAGCAGGG - Intronic
908030866 1:59997897-59997919 AACTAGCAAGATTTATAGCAAGG + Intronic
912612311 1:111060909-111060931 CAATATCTAGATCTGTAGCAAGG + Intergenic
914877059 1:151520013-151520035 AACAATCCTGAAATGCAGCAAGG - Intronic
916244382 1:162672406-162672428 AACTATTCAGAAATATAACAGGG - Intronic
918559607 1:185848737-185848759 AAGTATCCAGATATTTGGCTGGG - Intronic
919065779 1:192691469-192691491 AACTATGTACATATGTAGCTAGG - Intergenic
920748443 1:208651246-208651268 AAGTACCAAGAGATGTAGCAGGG + Intergenic
922266879 1:223992190-223992212 AACTATCCAGGTGTGCAACAGGG - Intergenic
1062917341 10:1251377-1251399 AACTATGGAGATATGTAAAAAGG + Intronic
1066003473 10:31126322-31126344 AAATATACATATACGTAGCAAGG - Intergenic
1066453814 10:35555130-35555152 CAGTATCCAGATCTGTAACATGG - Intronic
1072026138 10:91459865-91459887 TGCTATACAGATATGTAGCCTGG + Intronic
1078449061 11:11426818-11426840 AGCTGTGCAGATATGGAGCAGGG + Intronic
1080148049 11:29012488-29012510 AACTATCTAAATATCTATCATGG - Intergenic
1080155324 11:29104214-29104236 AAGTATTCAGATATATATCATGG - Intergenic
1082200940 11:49366283-49366305 AATTATGCAGATAAGTAGCAAGG + Intergenic
1085300574 11:75456006-75456028 AGCTGTTCAGACATGTAGCAGGG + Intronic
1086504057 11:87484589-87484611 AATTATCCAGTTATATAGCTAGG + Intergenic
1086654732 11:89339937-89339959 AATTATGCAGATAAGTAGCAAGG - Intronic
1088552524 11:111027417-111027439 AATTATCCAGAGCTGAAGCAAGG + Intergenic
1093854897 12:24089829-24089851 AACCATCCAGAAATGAAGAAGGG - Intergenic
1095304934 12:40627696-40627718 AACAATCCAGATAAGAAGTAGGG - Intergenic
1106635696 13:31526205-31526227 AAATATCCACAAATGTGGCAGGG - Intergenic
1108712397 13:53046483-53046505 GAAAAACCAGATATGTAGCAGGG + Intronic
1110043528 13:70797597-70797619 AACTATGAAGTTAGGTAGCATGG - Intergenic
1114153032 14:20066398-20066420 AACTACCTATATATTTAGCATGG + Intergenic
1114887493 14:26871999-26872021 AACTCTCCTGATAAGTATCAGGG + Intergenic
1123133328 14:106005979-106006001 TACTATTAAGATATGTAGCAGGG + Intergenic
1123165067 14:106318683-106318705 TACTATTAAGATATCTAGCAGGG + Intergenic
1123583353 15:21736424-21736446 TACTATTAAGGTATGTAGCAGGG + Intergenic
1123620003 15:22179021-22179043 TACTATTAAGGTATGTAGCAGGG + Intergenic
1126673008 15:51133476-51133498 CACTATCCAGATGTGTGGCCTGG - Intergenic
1127110209 15:55661155-55661177 AACTATCCAGATATTTCAAATGG + Intronic
1134111729 16:11519178-11519200 AACTTTCCAGACGTTTAGCAGGG - Intronic
1135603025 16:23799383-23799405 AAATATCAAGCTTTGTAGCATGG - Intergenic
1150832971 17:68540510-68540532 AAGTACACAAATATGTAGCAGGG - Intronic
1150948590 17:69775953-69775975 ATCTTTTCTGATATGTAGCATGG + Intergenic
1152306930 17:79526552-79526574 AAGTATCCTGATCGGTAGCAAGG + Intergenic
1153144928 18:2020320-2020342 AACTCTCCAGATAACTAGCAAGG + Intergenic
1157036288 18:43979050-43979072 AACTGCCCTGACATGTAGCATGG + Intergenic
1157131155 18:45008662-45008684 AACAATCATGATATGAAGCAGGG + Intronic
925567123 2:5268528-5268550 CAGTATACAAATATGTAGCATGG - Intergenic
929318264 2:40507810-40507832 AACTATCTTGATATGTATGAAGG - Intronic
930088858 2:47517465-47517487 AACTCTCTAGAGATGTACCAGGG - Exonic
932818824 2:74882293-74882315 AACCAGCCAGGTATGGAGCAGGG + Intronic
936161541 2:110087204-110087226 AACTATTGAGAGATGAAGCAGGG - Intronic
936183122 2:110284150-110284172 AACTATTGAGAGATGAAGCAGGG + Intergenic
937875780 2:126824218-126824240 AACTCTCAAGATCTGTAGGAAGG - Intergenic
938422113 2:131154224-131154246 ACCTCTCCTGAGATGTAGCAGGG - Intronic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940712699 2:157181432-157181454 AACAATCTAAATATGTATCAGGG - Intergenic
941228327 2:162876974-162876996 AACAATCCAAATATGTATTAAGG + Intergenic
942146667 2:173033851-173033873 CAATATCTAGATATGTATCATGG - Intronic
944370453 2:198976281-198976303 AAATATCCAGATAGGCAGTATGG + Intergenic
1169437824 20:5609327-5609349 AACTTGTCAGAAATGTAGCAAGG - Intronic
1169612973 20:7403982-7404004 AAGTTTCCATATATGTAGGATGG + Intergenic
1178464621 21:32835478-32835500 AACTAGCTAGATGTGCAGCAAGG - Intergenic
1183018916 22:35011653-35011675 CACTAACCAGATATGCAGGAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953320975 3:41971243-41971265 AAATATCAAGATATGTGGCTGGG + Intergenic
955572716 3:60325194-60325216 AATTATAAAAATATGTAGCATGG - Intronic
955779210 3:62465397-62465419 AATTATCCAGATATGACGAAGGG - Exonic
957427972 3:80064341-80064363 AGCTATCCAAATCTGTAGAAAGG + Intergenic
961152944 3:124655052-124655074 AATTATTCAGATAGGTATCATGG - Intronic
961159826 3:124714549-124714571 AACTTCCCAGAGATGTTGCAGGG + Intronic
961839729 3:129698999-129699021 AACTATCCAGATATGTAGCAGGG + Intronic
963585349 3:147179816-147179838 CACTAAGCAGATATGAAGCATGG + Intergenic
964475877 3:157097214-157097236 ACATATACAGATATGTAGAAGGG + Intergenic
965033937 3:163409688-163409710 AACTATCAATATATGTAACCTGG + Intergenic
966078563 3:175969935-175969957 AACTATCCAAATGTTTATCAAGG + Intergenic
966651069 3:182301683-182301705 AATTATCCAGAGATGTTGCAAGG - Intergenic
967606748 3:191456176-191456198 AAGTAAGCAGATATTTAGCATGG - Intergenic
972122194 4:35718207-35718229 TAGTATCCAAATATGTATCATGG + Intergenic
976527152 4:86106859-86106881 AATTATAAAGAAATGTAGCATGG + Intronic
977524987 4:98133168-98133190 GAGAATCCAGATAGGTAGCATGG - Intronic
977967423 4:103169069-103169091 AACAATCCAGAAATTTATCAAGG + Intronic
978668814 4:111221622-111221644 AAGGTCCCAGATATGTAGCAAGG - Intergenic
979180900 4:117725995-117726017 AACTACCCACAGATGTACCAAGG + Intergenic
987755418 5:22094654-22094676 ATCTATACTGATATGTAGCTGGG - Intronic
990047146 5:51446973-51446995 AGATATCCAGATATGAGGCAGGG - Intergenic
990567608 5:57045002-57045024 AACTATCCAGATATGCTGTATGG + Intergenic
990699888 5:58462966-58462988 AATAAGCCAGATATGAAGCATGG - Intergenic
990969658 5:61490098-61490120 AACTACCCAGATATTTAGGGAGG - Intronic
992525533 5:77606429-77606451 ATCTTTCCTGATATTTAGCATGG - Intronic
994320530 5:98389375-98389397 AAATAAACAGATATATAGCAAGG - Intergenic
994972129 5:106754307-106754329 TTCTGTCTAGATATGTAGCAAGG - Intergenic
996826855 5:127692635-127692657 AATTATCTTGATATTTAGCATGG - Intergenic
997952137 5:138250920-138250942 TACTATCCATATCTGTAACATGG - Intergenic
998892203 5:146758022-146758044 ACCTGTCCAGATATGGAGCTTGG + Intronic
1000885457 5:166743384-166743406 AATTATCTAGATCTGTAGGATGG + Intergenic
1002985378 6:2185580-2185602 AACTGCCCAGATGTGTACCAAGG + Intronic
1008684737 6:53912494-53912516 AAGCACCCAGATATGTAGAAAGG - Intronic
1010015377 6:71100088-71100110 GAATATCTAGATATCTAGCAAGG + Intergenic
1011828653 6:91341581-91341603 AAGTTTCTAGATATTTAGCATGG + Intergenic
1013143295 6:107362098-107362120 AACTAGCCAAATATTTAACAGGG + Intronic
1013815808 6:114095861-114095883 ACGTATCCAGAGATGTAACAGGG - Intronic
1017728664 6:157294892-157294914 TACTTTCCACATATGTAGAATGG + Intronic
1018235804 6:161722507-161722529 AAATTACCAGATATGTAGCCAGG - Intronic
1027672345 7:81117644-81117666 AAATAACTAGATAGGTAGCAAGG - Intergenic
1030106753 7:105993956-105993978 AACTACCCAAAGATGTAGGAAGG + Intronic
1043798464 8:84577227-84577249 CACTATCCACATATTTTGCAAGG + Intronic
1045227719 8:100266413-100266435 AACTATTCAGATACTTAGAAGGG - Intronic
1045318190 8:101061214-101061236 AACTAGGCAGATAGGCAGCAGGG + Intergenic
1047733971 8:127749798-127749820 GACTTTCCTGATTTGTAGCAGGG + Intergenic
1049918738 9:343979-344001 AATGATCCAGAAATGTAGGAGGG + Intronic
1055204968 9:73718190-73718212 AACCATCCTGATTTGCAGCAAGG + Intergenic
1056861534 9:90189034-90189056 AACTATTGATATATGCAGCAAGG - Intergenic
1059413050 9:114145695-114145717 ACCTATCCAGATATCTAGGAGGG - Intergenic
1186259227 X:7758147-7758169 AAAAATCCAGACATGTAGCCTGG - Intergenic
1189637973 X:43032486-43032508 AACTTTACAGATATTTGGCAAGG - Intergenic
1192374277 X:70543260-70543282 AACTATCCAGTCATGTTTCAGGG + Intronic
1193099368 X:77591499-77591521 AAATCTGAAGATATGTAGCAGGG - Intronic
1193957805 X:87884925-87884947 GACTATCCAGATATTTAAAACGG + Intergenic
1196661576 X:118276395-118276417 AATTAGCCAGAAATGTGGCATGG - Intergenic
1197518667 X:127470735-127470757 AGCTATCCAAAAATGAAGCAAGG - Intergenic
1198270774 X:135054113-135054135 ATCCATCCAGATATGTAGTCAGG + Intergenic
1201502260 Y:14658029-14658051 AAATATGCAGATATGTTACAAGG + Intronic