ID: 961843660

View in Genome Browser
Species Human (GRCh38)
Location 3:129740533-129740555
Sequence TCTCAACTCAACCACGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961843653_961843660 6 Left 961843653 3:129740504-129740526 CCAAATAATGTTTCCTAACTCAT 0: 1
1: 0
2: 2
3: 25
4: 267
Right 961843660 3:129740533-129740555 TCTCAACTCAACCACGGGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 77
961843652_961843660 7 Left 961843652 3:129740503-129740525 CCCAAATAATGTTTCCTAACTCA 0: 1
1: 0
2: 1
3: 33
4: 370
Right 961843660 3:129740533-129740555 TCTCAACTCAACCACGGGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 77
961843656_961843660 -7 Left 961843656 3:129740517-129740539 CCTAACTCATGGGAGTTCTCAAC 0: 1
1: 0
2: 0
3: 2
4: 93
Right 961843660 3:129740533-129740555 TCTCAACTCAACCACGGGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961843660 Original CRISPR TCTCAACTCAACCACGGGAA GGG Intronic
900469559 1:2846940-2846962 TCTCAACTCTGCAATGGGAAAGG + Intergenic
900677636 1:3898397-3898419 TCTCACCTCAGCCTCTGGAATGG - Intronic
902597038 1:17516575-17516597 TCTCATCTCACCCACCGGGAAGG - Intergenic
911231776 1:95369355-95369377 TCACATCTAAACCATGGGAAGGG - Intergenic
918046790 1:180946377-180946399 TCTCAATTCAACCCAGGCAATGG + Exonic
918728256 1:187953783-187953805 TCCCAGCTCAACCACAGAAAGGG + Intergenic
920285077 1:204873458-204873480 TGTCCACTAAACCACGGGAGTGG - Intronic
921314281 1:213875743-213875765 TCACAACCCACCCACGTGAATGG + Intergenic
1077111373 11:863647-863669 TCCCAAGTCACCCATGGGAAAGG - Intronic
1078555762 11:12324814-12324836 TCCCAAGTCAGCCACGGGGAAGG - Intronic
1080896352 11:36451686-36451708 TCTCTACTCAACCAGAGGGAGGG - Intronic
1081453472 11:43196634-43196656 TCTAAACTCAGTCACTGGAAAGG + Intergenic
1088125389 11:106417799-106417821 TCTCAACCCAACAACTGTAATGG - Intergenic
1088781091 11:113135016-113135038 CCTCAACTCAATGACGGGTAAGG - Intronic
1092957520 12:13563687-13563709 TCTCACATCAAGCACGGGACGGG - Exonic
1093222542 12:16440079-16440101 TCTCAACTCAACCAACAGACTGG + Intronic
1093393375 12:18650956-18650978 TCTCAACACAGCAATGGGAATGG + Intergenic
1096662862 12:53139552-53139574 TCTAAAATCAGCCATGGGAAGGG + Intergenic
1096929804 12:55194871-55194893 TCTCTACTGAACCACAGCAAAGG + Intergenic
1097210853 12:57368511-57368533 TATCAACTCAACCTCAGGAAGGG + Intronic
1101797310 12:107987189-107987211 AATCACCTCAGCCACGGGAAAGG + Intergenic
1104852611 12:131884451-131884473 CCCCCACTCAGCCACGGGAAAGG + Intergenic
1104852621 12:131884479-131884501 CCCCCACTCAGCCACGGGAAAGG + Intergenic
1105409467 13:20160180-20160202 TCTCAAGTCTCCTACGGGAAGGG + Intronic
1107686586 13:42906506-42906528 TCTCAACACAACAAGAGGAAAGG + Intronic
1108017289 13:46089331-46089353 TCTCAACACAACCACACGGAAGG - Intronic
1112371758 13:98800225-98800247 TCTCAAGTCACCCAGGGGCAAGG + Intronic
1115768341 14:36646718-36646740 TCTCTACACCACCACTGGAAAGG - Intergenic
1118055729 14:62077737-62077759 TCTCAAATCAACCCAGGGAGGGG + Intronic
1125482033 15:40087743-40087765 TCTCAACTCCAAGAGGGGAAAGG + Intergenic
1134400463 16:13905137-13905159 TCTAAACTCCACCAGGGAAAGGG - Intergenic
1135670935 16:24374943-24374965 TCTAAACTCACCCCAGGGAAAGG + Intergenic
1136293141 16:29287754-29287776 TCTCCCCACAGCCACGGGAAGGG - Intergenic
1140814239 16:78605812-78605834 ACTCCACTTAACCAGGGGAAAGG - Intronic
1142099025 16:88261761-88261783 TCTCCCCACAGCCACGGGAAGGG - Intergenic
1143001806 17:3799313-3799335 GCTCAGCTCAGCCACGGGAAGGG - Intronic
1150840633 17:68602229-68602251 TCTCAATTCCAGCAAGGGAAGGG - Intergenic
1153997926 18:10457334-10457356 ACTCAACCTAACCAAGGGAATGG + Intronic
1155397077 18:25397968-25397990 TCCCACCTCAAGCACAGGAAAGG + Intergenic
1161056242 19:2191854-2191876 TCTCCTCTCAACCACGGGCGGGG + Intronic
1167086779 19:47315385-47315407 TCTGAAGTCAACCAGAGGAAAGG + Intronic
925171254 2:1751517-1751539 TGTCAGCTCAACCACAGCAAAGG + Intergenic
927336543 2:21931139-21931161 TAGCAACTCAACCAGGGGACAGG + Intergenic
933258968 2:80110604-80110626 TCTCACCTACACCACAGGAAAGG - Intronic
934578716 2:95420748-95420770 TCTCAAGTAAACTATGGGAAAGG + Intergenic
947997047 2:234536729-234536751 ACTCAACTCTGCCACGGTAATGG + Intergenic
1176677614 21:9794404-9794426 TCTCATCTCAAACAAGGGAAGGG - Intergenic
1178713550 21:34942695-34942717 TGTCATCTCAACCATGGAAAGGG - Intronic
1181684455 22:24518962-24518984 TCTCAAAACCACCAGGGGAAAGG - Intronic
1183978696 22:41527481-41527503 GCCCAACTCAGCCACGGGCAGGG - Exonic
949329934 3:2910604-2910626 ACTCAATTCAAACAGGGGAAGGG - Intronic
952399934 3:32953998-32954020 TCTCAACTCCACGACGTGGAAGG + Exonic
961843660 3:129740533-129740555 TCTCAACTCAACCACGGGAAGGG + Intronic
975939242 4:79621771-79621793 ACTCAACTCACCTAAGGGAATGG + Intergenic
976573813 4:86644915-86644937 TCTCAACTCAACGCCGGGCTTGG + Intronic
981861849 4:149364855-149364877 TTTCAACTCAATCAAGGGCAAGG + Intergenic
984907265 4:184640197-184640219 TCTCAATTTAACCACAGGAGAGG + Intronic
985291372 4:188391407-188391429 TCTAAACTCCACCAGGGAAAGGG + Intergenic
985397922 4:189564371-189564393 TCTCATCTCAAACAAGGGAAGGG + Intergenic
989134508 5:38140056-38140078 TCTTAAATCAGCCACAGGAAAGG + Intergenic
991081005 5:62599164-62599186 TTTCAGCTCAACCACTTGAAGGG - Intronic
999001830 5:147932057-147932079 TCTCCACTCAAACACAGGCAAGG - Intergenic
999153424 5:149441730-149441752 TTTAAACTCAACCAAGGGCAGGG + Intergenic
1000824243 5:166024338-166024360 GCTTCACTCATCCACGGGAAAGG + Intergenic
1001170368 5:169413838-169413860 TCTCAATACAACCATGGGTAGGG - Intergenic
1004273665 6:14216503-14216525 TCTCAACTCAGCCACATGGAAGG + Intergenic
1004789724 6:19011542-19011564 TCTCACCTCAACCAGGACAAGGG + Intergenic
1020920764 7:14261532-14261554 TATCAAGTCAATCACTGGAAAGG - Intronic
1029111639 7:98215790-98215812 TCTCAGATCAATCACGGGAAGGG - Exonic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1037658174 8:20905322-20905344 TCACAACTGATCCACAGGAAGGG - Intergenic
1043160485 8:76840728-76840750 TTTCAACTCATCCCGGGGAAGGG - Intronic
1047106745 8:121739792-121739814 TCTCAAGCCAAACACTGGAAAGG - Intergenic
1049577488 8:143396462-143396484 TCACAAGTCAGCCACGGGGAGGG - Intergenic
1049873869 8:145002815-145002837 ACTCGGCTCGACCACGGGAAGGG + Intergenic
1053120390 9:35542166-35542188 TCTCCACACAACCAAGAGAAAGG - Intronic
1054783619 9:69189318-69189340 TCTCCACTGAACCCTGGGAAGGG + Intronic
1057637494 9:96783537-96783559 TCCCAAATGAACCACGGTAAAGG - Intergenic
1188061371 X:25606013-25606035 GCTCAACTAAAACCCGGGAATGG - Intergenic
1192315619 X:70049236-70049258 ACTCACCTGAACCACTGGAAAGG + Intronic
1193694487 X:84691476-84691498 TTTCAACTCTAACATGGGAAGGG + Intergenic
1199174143 X:144764802-144764824 TCTCAACTCATTCTCGGTAAAGG - Intergenic
1201503989 Y:14677569-14677591 TCTCAACTCTCCCTCTGGAAAGG + Intronic