ID: 961847440

View in Genome Browser
Species Human (GRCh38)
Location 3:129778412-129778434
Sequence GTTCCATCACTGATGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961847440 Original CRISPR GTTCCATCACTGATGAAATA AGG Intronic
901156369 1:7142312-7142334 GTTCCAGCACAGAGGAAAAAAGG - Intronic
902857990 1:19223142-19223164 GTTGCATCATTGTTAAAATAGGG - Intronic
903413213 1:23163884-23163906 GTTCCCTCATTTATAAAATAAGG + Intronic
903572438 1:24316281-24316303 GTTTCTTCACTTGTGAAATAAGG + Intergenic
910285492 1:85549669-85549691 CTTCCATCAGTGATGAAGAAAGG + Intronic
911543964 1:99193378-99193400 GTTTCATCACTTACAAAATATGG - Intergenic
917719706 1:177775760-177775782 GTTCCCTCACTGAAGAATAAGGG + Intergenic
920848027 1:209609793-209609815 TTTCCATCAGTCATGAAATCTGG + Intronic
921376962 1:214484556-214484578 GTTCCATGTTTGATGAAACAAGG + Intronic
924807944 1:247376299-247376321 GTTTCCTCACTCATCAAATAAGG + Intergenic
1066120879 10:32285887-32285909 TTTCCATCACTGCTGACATCAGG - Intronic
1067422258 10:46162554-46162576 GTTCCAACAATGTTCAAATAAGG - Intergenic
1067507565 10:46868651-46868673 GTTCCAACAATGTTCAAATAAGG - Intergenic
1068013389 10:51482788-51482810 GTTTCATCATTCATGAAATAGGG + Intronic
1070705704 10:78636457-78636479 GTTCCATAACCTATGAAACATGG - Intergenic
1071575635 10:86723966-86723988 GTTCCATCACAGAAGTCATAAGG - Intronic
1073853250 10:107645518-107645540 ACTCCATCATTGATGAAAGATGG - Intergenic
1074952993 10:118358057-118358079 GTTCATTCAGTGATGAATTAAGG - Intergenic
1075140661 10:119832162-119832184 GTTCCTTGACTGATGTAGTAAGG + Intronic
1076801322 10:132831316-132831338 GTTCCATCACTGTTGAGAAAGGG + Intronic
1080322386 11:31027084-31027106 TTTGCATCATTTATGAAATATGG + Intronic
1084866467 11:72062184-72062206 GTTCCTCCACTGATGATATGGGG - Intronic
1089376119 11:117996051-117996073 GTTTCCTCACTTATGAAATGGGG - Intronic
1089473860 11:118742744-118742766 GTTCCCTGACCCATGAAATAAGG - Intergenic
1097172326 12:57123637-57123659 GCTCCATCACTCATGCATTAAGG + Intronic
1097176048 12:57143508-57143530 GTTTCTTCACTTGTGAAATATGG + Intronic
1098044349 12:66384697-66384719 GTTTCAGGCCTGATGAAATATGG - Intronic
1098134422 12:67387037-67387059 GTAATATCACAGATGAAATAAGG - Intergenic
1098611918 12:72469088-72469110 ATTCCCTCACCTATGAAATAAGG - Intronic
1100638141 12:96455759-96455781 GTTCTATTACTGATGAAGAAGGG + Intergenic
1100802421 12:98247367-98247389 GTTCCATCAGTGAGGAAGTAGGG - Intergenic
1101980013 12:109397849-109397871 GTTCCGTCACTGGCAAAATAAGG - Intronic
1105307642 13:19180345-19180367 GTCCCAGCACTGATGACATCTGG - Intronic
1106992742 13:35441610-35441632 GCTCCATCAGTGATCAATTAGGG + Intronic
1108533135 13:51346048-51346070 GTTCCCTCACCTGTGAAATAGGG + Intronic
1110376092 13:74795170-74795192 GTTCCCTCCCTGTTGAAAGAGGG - Intergenic
1110576993 13:77069126-77069148 GTGCCTTCAGTGATAAAATATGG - Intronic
1111714377 13:91861283-91861305 GTTCTATCAGTGATGAACAAAGG + Intronic
1112120658 13:96407407-96407429 GTTCTTTCACTGGTGAAATGGGG + Intronic
1112766206 13:102747134-102747156 TTTCCCTCATTAATGAAATATGG + Exonic
1113015903 13:105827984-105828006 GTTCCATCAGTTAAGAAAAATGG - Intergenic
1118945274 14:70380102-70380124 GTTTTATCACTTATAAAATAGGG - Intronic
1119109249 14:71956247-71956269 GTTCCATCAGTGTTGGAATTTGG + Intronic
1119404205 14:74386590-74386612 CTTCCACCACTCATGAACTAGGG + Intergenic
1119991429 14:79202289-79202311 GTTCCATACCTGAGAAAATAAGG + Intronic
1120119542 14:80662142-80662164 GTTGAAACACTGATGAAAAATGG + Intronic
1120428979 14:84389752-84389774 GTTTCATTACTTATGAAATGGGG - Intergenic
1121640286 14:95480793-95480815 GTGCTAACACTCATGAAATAAGG + Intergenic
1122335911 14:100982991-100983013 GGTCCATCACAGATAAAATCTGG + Intergenic
1122874125 14:104655394-104655416 TTTCCAGAACTGATAAAATATGG + Intergenic
1126311359 15:47320411-47320433 GTTGCTGCACTGATAAAATAAGG - Intronic
1126587899 15:50307827-50307849 TTTCCAGAACTGATGAAAGATGG - Intronic
1127496983 15:59522572-59522594 TTTCAATGACTGATCAAATATGG - Exonic
1133507604 16:6427368-6427390 GTTCCCACATTGTTGAAATATGG + Intronic
1135193366 16:20373695-20373717 GTTCAATCATTGTTAAAATAAGG + Intronic
1135266879 16:21034430-21034452 GCTCCATCACTGATGAACTTGGG - Intronic
1136653581 16:31694896-31694918 GTTCCATCCCTGATTCAATCTGG + Intergenic
1138012147 16:53391811-53391833 TTGCCATTACTGATGAAATTAGG + Intergenic
1138166973 16:54811743-54811765 GTTTCCTTACTGATGAATTAGGG - Intergenic
1138877901 16:60975165-60975187 GTTTCATCACTGGTAACATAGGG + Intergenic
1139239434 16:65375685-65375707 GTTCCAAGACTAATAAAATATGG - Intergenic
1141552858 16:84817791-84817813 GTTCCATCATTGAAAAAATGAGG + Intergenic
1141564957 16:84895161-84895183 CTTCCTTTACTGATAAAATAGGG - Intronic
1143200286 17:5108747-5108769 GTTTCATCACTCATAAAATTAGG - Intronic
1146981709 17:37168126-37168148 GTTCCTTCACTGGTAAAACAAGG + Intronic
1147113056 17:38278152-38278174 GTTTCTTCACTCATGAAATAGGG + Intergenic
1148416566 17:47511082-47511104 GTTTCTTCACTCATGAAATAGGG - Intergenic
1149656340 17:58311376-58311398 GTTCCATCACTGAAGCCATATGG - Intronic
1150536757 17:66050780-66050802 GTTCCTTCACTGCTGATTTAGGG + Intronic
1156721473 18:40075428-40075450 GTTTCCTCATTGATAAAATAAGG + Intergenic
1156729007 18:40167047-40167069 GGTCCATCACAGATGGCATATGG + Intergenic
1157205012 18:45690462-45690484 GATCCATGACTGATGAGTTATGG - Intergenic
1157747781 18:50151569-50151591 GTTTCATCACTTATAAAATTGGG + Intronic
1161879560 19:6938601-6938623 GTTTCCTCACTGATAAAATGGGG + Intronic
1164294852 19:23900891-23900913 CATCCATCACCTATGAAATAGGG + Intergenic
1165798176 19:38531347-38531369 GTTCCCCCACCGATAAAATAGGG + Intronic
925057633 2:867333-867355 GTTTCACTACTCATGAAATAGGG - Intergenic
928382058 2:30826657-30826679 GTTCAAACAGTGTTGAAATAAGG + Intergenic
930679726 2:54243859-54243881 TTTCCATCAGTGATGGACTATGG - Intronic
931917293 2:66969985-66970007 CTTTCCTCACTGATAAAATAAGG + Intergenic
932166998 2:69517343-69517365 GTGCCATCCCTGATGAATTAAGG + Intronic
932394360 2:71430603-71430625 TCTCCATCTCTGAAGAAATAGGG + Intronic
937911944 2:127080101-127080123 GTTCCCTCATGGATGAAATGGGG - Intronic
940608135 2:155953948-155953970 GTTTCTTCACTCATAAAATAGGG - Intergenic
940692624 2:156938138-156938160 ACACCATCACTGAAGAAATATGG + Intergenic
943615642 2:190088891-190088913 GTTTCATCAATTATGAAGTAAGG + Intronic
945094267 2:206203924-206203946 GTTCCTTCATCGATGATATAGGG + Intronic
947805926 2:232968041-232968063 GTTCCATCAGTGAGGAAGAAGGG - Intronic
1172016233 20:31875206-31875228 GTTTCATCATCTATGAAATAGGG + Intronic
1172823960 20:37764170-37764192 GTTTCCTCACTTATGAAATGGGG - Intronic
1175279302 20:57792662-57792684 GTCCCTTCACTGAGCAAATACGG + Intergenic
1175569973 20:60010978-60011000 GCTACGTGACTGATGAAATAGGG - Intronic
1177542799 21:22517445-22517467 GTTATATGACTGCTGAAATATGG - Intergenic
1178636649 21:34309431-34309453 GTTTCACCAGTGATAAAATAAGG + Intergenic
1180714606 22:17863321-17863343 AATCCATCTCTGATGAAATAGGG + Intronic
952089404 3:29865951-29865973 CTTCCTTCACTGGTAAAATAGGG + Intronic
955084573 3:55690311-55690333 TTTCTATAACTGATGTAATAGGG - Intronic
955115835 3:56000667-56000689 CTTCCAGCACTGATTAAAAATGG - Intronic
956445744 3:69324067-69324089 GGCCCCACACTGATGAAATATGG + Intronic
959741338 3:109723819-109723841 CTTCAATCATTGGTGAAATAAGG + Intergenic
959752900 3:109859270-109859292 TTTCCACCATTGATCAAATAGGG + Intergenic
960383576 3:116993160-116993182 GTTCCTTCACTAAAGAAATATGG + Intronic
960753261 3:120979961-120979983 GTTGCATCAATAATGAAATTAGG - Intronic
960944290 3:122955688-122955710 GTTTCATCACCTGTGAAATAAGG + Intronic
961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG + Exonic
961782033 3:129326049-129326071 GGGCCAACACTGAAGAAATAAGG + Intergenic
961847440 3:129778412-129778434 GTTCCATCACTGATGAAATAAGG + Intronic
964931085 3:162024071-162024093 GTTCTGTCTATGATGAAATATGG + Intergenic
966583494 3:181594893-181594915 GTTACTTCACTGTTAAAATAGGG - Intergenic
967152843 3:186665416-186665438 GTTCCCTCATTTACGAAATATGG - Intronic
967292294 3:187932966-187932988 GTTCAAGCAATGAAGAAATAAGG + Intergenic
969224570 4:5786920-5786942 TTTTCATCAATGAGGAAATATGG - Intronic
969321106 4:6413457-6413479 GCTCCATAAGTGATGAAATTGGG - Intronic
970326675 4:14932379-14932401 GGTCCCTCACTGATGCAAAAAGG - Intergenic
971400980 4:26275109-26275131 GTTGCTTCATTTATGAAATAGGG - Intronic
971760888 4:30763685-30763707 TTTTCATTAATGATGAAATAGGG + Intronic
974210609 4:58769588-58769610 GTTCCATCAGTGATGGATTAGGG - Intergenic
974981750 4:68965918-68965940 GTTGCATAACTTATGAAGTAAGG - Intergenic
975675604 4:76824495-76824517 GTTTCATTACTGAGGAAAAAAGG - Intergenic
977525596 4:98142232-98142254 GTTACATAACTGATCAGATAAGG - Intronic
977675175 4:99739594-99739616 GTTGCAGAAATGATGAAATATGG - Intergenic
978335351 4:107661947-107661969 GTTCCATCTTTGAGGAAACAGGG - Intronic
978503200 4:109431460-109431482 GTTTCTTCACAGATAAAATAGGG + Intergenic
981110938 4:140932642-140932664 GTTTCTTCACTGATAAAATGAGG + Intronic
982872506 4:160600651-160600673 TTTCCACCACTGATGAAATAAGG - Intergenic
983430621 4:167645411-167645433 GTTCCCAAACTGATGAAAGATGG + Intergenic
984411345 4:179402039-179402061 GTTAAATCAGTGATAAAATACGG - Intergenic
984661309 4:182378663-182378685 GTGGCATAACTCATGAAATAAGG + Intronic
985220813 4:187702380-187702402 GTTCCTTCATTGCTGAGATAAGG - Intergenic
986340000 5:6780738-6780760 CGTCCATCAGTGATGAAAGAAGG - Intergenic
987856829 5:23430403-23430425 GTTTCATTGCTGATGAACTATGG + Intergenic
990449926 5:55924583-55924605 GTCCCATGACTGTTGGAATAAGG + Intergenic
990974911 5:61551265-61551287 GTTTCTTCACTGGTAAAATAAGG - Intergenic
991146220 5:63308188-63308210 GTTCCAACATTTATGAAATGAGG + Intergenic
991963927 5:72072614-72072636 CTTCATTCACTGAAGAAATAGGG + Intergenic
992925186 5:81576452-81576474 GTTTCTCCACTGATAAAATAAGG - Intronic
994988118 5:106963895-106963917 GTTCAAGGACTGATGACATATGG - Intergenic
995380517 5:111527146-111527168 GTTTCATCACAGATGATAAAAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995927915 5:117397790-117397812 TTTCCATCAGTGCTGAAGTATGG - Intergenic
998198454 5:140097330-140097352 GTTTCCTCACTTATCAAATAAGG - Intergenic
998380252 5:141719387-141719409 ATTCCACCACTAATGAAAAAGGG + Intergenic
999737428 5:154523175-154523197 GTTCCATCACTGCTGTGATGGGG - Intergenic
1000386206 5:160676851-160676873 GTTTCATCATCTATGAAATAGGG - Intronic
1000551430 5:162670243-162670265 GTGCCATGAAGGATGAAATAAGG - Intergenic
1000633034 5:163612702-163612724 GTTTCATCACTGGTGAGAAAAGG + Intergenic
1001171706 5:169425472-169425494 GTTCCAGCACTTATGAATTAGGG + Intergenic
1004638541 6:17491750-17491772 GTTCCCTCACTCATAAAACAGGG + Intronic
1008910569 6:56727948-56727970 GTTTTCTCACTGATAAAATAAGG + Intronic
1008952786 6:57178702-57178724 GTTCTATAAATGATGAAATCTGG + Intronic
1013611469 6:111799901-111799923 TTTCCAGCACTGGTTAAATATGG + Intronic
1014145591 6:117994568-117994590 GTTTCTTCACTTATAAAATAGGG - Intronic
1014648271 6:124003402-124003424 GTACCATCAGAGGTGAAATATGG - Intronic
1015612660 6:135042237-135042259 TTTTCATCCCTTATGAAATATGG - Intronic
1015782458 6:136882979-136883001 TCTACATCACTGATTAAATAGGG + Intronic
1016165907 6:140943157-140943179 GTTCCACCGCTGATTAATTAAGG - Intergenic
1016358325 6:143241671-143241693 GTTCCCTCACCTATAAAATAGGG - Intronic
1016849636 6:148604214-148604236 GATGCTTCACTGAAGAAATACGG - Intergenic
1018364661 6:163107416-163107438 GATCCACCACCAATGAAATAAGG - Intronic
1019227148 6:170522735-170522757 GCTCCCTCACTTATGAAATGTGG - Intergenic
1020984153 7:15111319-15111341 GTTCCATCATTGATGGAAATAGG + Intergenic
1021285866 7:18780200-18780222 GTTCCTTCACCTATGAAGTAAGG + Intronic
1022780670 7:33579292-33579314 GTTCCATCTCAGATAGAATAGGG - Intronic
1026245664 7:68617342-68617364 GTTCCTTCACTTGTTAAATAAGG - Intergenic
1031057710 7:117011487-117011509 GTTCCTTCACTGGTAAAATGAGG - Intronic
1031634661 7:124087094-124087116 ATTTCATAACTGATGAAATGAGG - Intergenic
1034754919 7:153607293-153607315 CTTCCATCAGTGGTGAAATGGGG - Intergenic
1038882436 8:31629058-31629080 GTGCCATCATTGATGGAATGGGG + Intergenic
1039347564 8:36724708-36724730 GTTTCATCACCTTTGAAATAAGG - Intergenic
1040479592 8:47812202-47812224 GTTCCATCACTGCTGAGAAAAGG - Intronic
1040629334 8:49191474-49191496 GTACAATGACAGATGAAATAAGG + Intergenic
1041816115 8:61973446-61973468 GTAGCATCACTTATAAAATAAGG - Intergenic
1043083899 8:75802751-75802773 ATTCTATAACTGATGCAATATGG - Intergenic
1047340328 8:123974863-123974885 GTTCCATCTTTGATGGAATAGGG - Intronic
1047695202 8:127396461-127396483 CATCCTTCACTCATGAAATAGGG + Intergenic
1048651833 8:136486536-136486558 GTTCAAACTCTGTTGAAATAAGG - Intergenic
1050209957 9:3242181-3242203 TTTTCCTCACTGGTGAAATAGGG + Intronic
1052522865 9:29571988-29572010 ATTCCATAACTGTTGTAATAAGG + Intergenic
1054969390 9:71067891-71067913 GTTTCATCACTGGTGAAATCAGG + Intronic
1054984688 9:71247817-71247839 GATCCAACAATCATGAAATAGGG + Intronic
1055270569 9:74553436-74553458 GTTCTGTTACTGATAAAATATGG - Intronic
1056527652 9:87458143-87458165 GTTTCCTCACTTATGAAATAAGG - Intergenic
1187032050 X:15498144-15498166 GTTCAATCCTTCATGAAATAAGG - Intronic
1187720371 X:22144092-22144114 GTTTCCTCACTCATGAAATGGGG + Intronic
1188788034 X:34373162-34373184 GTTACCTCACTTATGTAATAAGG - Intergenic
1189355077 X:40304424-40304446 GTCCCATCACTCATGAGTTAAGG + Intergenic
1189995870 X:46637184-46637206 GTTTCCTCACTGATTAAATGGGG - Intronic
1192843332 X:74880309-74880331 GTTCCATTGCTGGTGAAAGAGGG - Intronic
1194338073 X:92673881-92673903 CTCCCATCACTGTTGCAATAAGG - Intergenic
1194903916 X:99549718-99549740 CTTCTATCACTGTGGAAATAAGG + Intergenic
1195484974 X:105393881-105393903 GTTTCCTCACTTATGAAATAGGG - Intronic
1197327180 X:125108371-125108393 GTTTCCTCACTTATTAAATAGGG + Intergenic
1199030009 X:142986630-142986652 GTGAGATCACAGATGAAATACGG + Intergenic
1200646475 Y:5790616-5790638 CTCCCATCACTGTTGCAATAAGG - Intergenic
1200757196 Y:7001063-7001085 GTTCCCTCACTTATAAAATGGGG - Intronic
1202051572 Y:20786581-20786603 CTGCCATCTGTGATGAAATATGG - Intergenic