ID: 961851683

View in Genome Browser
Species Human (GRCh38)
Location 3:129825895-129825917
Sequence AGATGTACACTTAAAACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961851683 Original CRISPR AGATGTACACTTAAAACTGG TGG Intronic
901205888 1:7495730-7495752 TGATAAACACTTAAATCTGGGGG - Intronic
904317006 1:29672095-29672117 AGATGCATAATTAGAACTGGAGG - Intergenic
905716356 1:40154104-40154126 AGCTATACACTTCTAACTGGAGG - Intergenic
906923124 1:50086141-50086163 ACATGTACATTTAAAACTTCAGG - Intronic
907515038 1:54988425-54988447 AGTCGTAGACTCAAAACTGGGGG + Intronic
909037411 1:70609691-70609713 AAAAGTATACTCAAAACTGGAGG - Intergenic
912129604 1:106585545-106585567 AGATGTACCCTTAATCTTGGTGG - Intergenic
915433567 1:155886004-155886026 AGAAGTACAGCTAAAACAGGGGG + Intergenic
916429056 1:164710319-164710341 AGATGTTGAATTTAAACTGGGGG + Intronic
918259714 1:182784607-182784629 AGAAGAACATTTAAAACTGAGGG + Intergenic
921052166 1:211518426-211518448 AGATGTAAAATTGAACCTGGTGG + Intergenic
922054258 1:222025226-222025248 AGATTTTCATTAAAAACTGGGGG - Intergenic
923592765 1:235334469-235334491 AAATGTACACTTTAAATGGGTGG - Intronic
923771419 1:236941151-236941173 AGATATACAGGTAAAGCTGGAGG + Intergenic
1063077271 10:2730018-2730040 AGATGTATACTTAGAAATGTTGG - Intergenic
1064075143 10:12262764-12262786 AGATCTACAGATAAGACTGGGGG + Intergenic
1064260515 10:13781941-13781963 AACTGCACACTTAAAAATGGCGG + Intronic
1066414919 10:35213066-35213088 AGATCCACTCTTGAAACTGGGGG - Intergenic
1067037626 10:42931890-42931912 AGATGAACACATTTAACTGGGGG - Intergenic
1070227271 10:74522690-74522712 AGATATTCACTTATAACTGAGGG - Intronic
1074784040 10:116823083-116823105 GGATGTTCACTTCAAACTTGTGG - Intergenic
1080152819 11:29074260-29074282 ATATATACACCTAAAACTGGAGG - Intergenic
1082998483 11:59271369-59271391 AGATGCACACATAAAACTCTAGG + Intergenic
1084874666 11:72122245-72122267 AGATGTATAGTTAAAATAGGTGG - Intronic
1087677843 11:101182996-101183018 AGATATACACTAAATCCTGGAGG - Intergenic
1087961460 11:104355593-104355615 AGATGGAAACCTAAAACTGAGGG - Intergenic
1088711174 11:112510017-112510039 AATTGTACACTTTAAACAGGTGG - Intergenic
1092756828 12:11771440-11771462 AGAGATAAACTTCAAACTGGTGG + Intronic
1093246523 12:16744644-16744666 AGATGTACAAATCAAAGTGGTGG - Intergenic
1094750387 12:33399320-33399342 TGAATTACATTTAAAACTGGTGG + Intronic
1097384704 12:58935918-58935940 GGATATACACTTAAAACTTCTGG + Intergenic
1097562640 12:61227179-61227201 AGATGTACATATAAAATTGAAGG - Intergenic
1098458614 12:70705559-70705581 AGATGTACTTTTGAAACTGTTGG + Intronic
1099557624 12:84129102-84129124 TGAGGTACACAGAAAACTGGAGG - Intergenic
1100015220 12:90002043-90002065 AGATTTATAGTTAAAACTGTTGG + Intergenic
1100976591 12:100129135-100129157 AGAATTACAGTTAAAAGTGGGGG - Intronic
1102567570 12:113806953-113806975 ACATGTACACTTCACAATGGTGG + Intergenic
1103416790 12:120747573-120747595 GGCTGTACACTTAAAATAGGTGG + Intergenic
1103468335 12:121159994-121160016 GTATGTACACTTTAAAATGGTGG - Intronic
1103919913 12:124393977-124393999 AAATGTACAGTGACAACTGGAGG - Intronic
1106199088 13:27521251-27521273 AATTGTACACTTTAAAATGGTGG + Intergenic
1106200411 13:27532019-27532041 ACATGTACACTGAAAACTACAGG - Intergenic
1106497456 13:30293555-30293577 AACTGTACACTTAAAATTAGTGG - Intronic
1109478689 13:62919310-62919332 TGAGGTACACGGAAAACTGGAGG + Intergenic
1109608980 13:64738650-64738672 TGATGTACATTTAAAAATGAGGG + Intergenic
1109614477 13:64812382-64812404 ATAGATACACTTAAAATTGGAGG - Intergenic
1110207233 13:72929602-72929624 AATTGTACACTTTAAATTGGTGG + Intronic
1112171669 13:96978780-96978802 AGATGTTCAATTAGAAGTGGAGG + Intergenic
1112618302 13:101027909-101027931 AGACCTACAGTTATAACTGGTGG + Intergenic
1112686632 13:101835972-101835994 AGTTGTACTTTTAAAAATGGGGG + Intronic
1113365008 13:109667737-109667759 TGATTTAAACTTCAAACTGGAGG - Intergenic
1113569000 13:111339849-111339871 GGATGTAAACTGAAAAATGGTGG - Exonic
1115016513 14:28621818-28621840 AGATGGGGACCTAAAACTGGAGG + Intergenic
1115746697 14:36445041-36445063 AAATGTACACTTCAAACTCCAGG - Intergenic
1116513202 14:45772048-45772070 AGCTGTACATTTAAAACTACTGG - Intergenic
1117959267 14:61147147-61147169 AGCTGTAGACTGGAAACTGGAGG - Intergenic
1118698433 14:68409135-68409157 AACTGTACACTTGAAATTGGAGG + Intronic
1119000629 14:70878457-70878479 AGAAGTGCATTTAAAAATGGGGG - Intergenic
1119549787 14:75500180-75500202 GGATGTTCACTCAAAACTGCAGG + Intergenic
1120026932 14:79596915-79596937 AGATACACATTTAAAACTTGGGG - Intronic
1120336882 14:83168830-83168852 AGATCAACACATAAAACTTGAGG + Intergenic
1121193751 14:92052044-92052066 AGATGTAGACTGAAATCAGGAGG - Exonic
1124815125 15:32982597-32982619 AGATTAACATTTAAATCTGGAGG + Intronic
1125408058 15:39374015-39374037 AGATATACACTTAAAACAAAAGG + Intergenic
1127184369 15:56462836-56462858 AGATGTACACTTAACTATGTAGG + Intronic
1127573750 15:60270341-60270363 ATATATGCACTTAATACTGGAGG - Intergenic
1130246499 15:82254928-82254950 AGATGTAGACCTTCAACTGGTGG + Intronic
1135478776 16:22803067-22803089 AGCTGAAGACTCAAAACTGGAGG + Intergenic
1137298807 16:47125855-47125877 AATTGTAAACTTAAAAATGGTGG - Intronic
1137304905 16:47189240-47189262 AATTGTACACTGTAAACTGGTGG - Intronic
1140103547 16:71938841-71938863 TGAGGTACACTGACAACTGGAGG - Intronic
1141452616 16:84115838-84115860 AATAGTACACTTAAAACAGGTGG + Intronic
1141737525 16:85863521-85863543 AATTGTACACCTAAAACTAGTGG - Intergenic
1141988167 16:87593435-87593457 AACTGTACACTTCAAACAGGCGG + Intergenic
1143542935 17:7580324-7580346 AGAGGTAAAGCTAAAACTGGGGG + Exonic
1144374247 17:14623313-14623335 ACTTGTAAACTTAAAAATGGTGG - Intergenic
1146599075 17:34197608-34197630 ATATCTACACTTAAAACTTTAGG + Intergenic
1146691993 17:34883105-34883127 AAATGTACACTTAGAAATGGTGG - Intergenic
1149167650 17:53772631-53772653 AACTGTACACTTAAAAATGGCGG - Intergenic
1150019522 17:61596969-61596991 AGATATACACTTAAAGCTGGTGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153372255 18:4332591-4332613 TGATGTGGACTTAAAACTAGAGG + Intronic
1159228778 18:65577085-65577107 AGTTGTAAGCTGAAAACTGGCGG - Intergenic
1160358562 18:78249633-78249655 AGATTTACAAATAAAATTGGTGG - Intergenic
1164582867 19:29445669-29445691 AGATGGCCATTTAAAACTGAAGG - Intergenic
1165668954 19:37658426-37658448 AAAACTACACTCAAAACTGGGGG - Intronic
1167808599 19:51808744-51808766 TCATGTACACATAAAACTGATGG - Intronic
926510108 2:13765598-13765620 AACTGTACACTTAAAATTGGTGG + Intergenic
926636931 2:15190414-15190436 AAATACACACTTAAAGCTGGTGG + Intronic
927106284 2:19830210-19830232 AAAAGTACATTTAAAACTGTAGG + Intergenic
927639461 2:24837625-24837647 AGATGGACTCTCATAACTGGAGG + Intronic
927727107 2:25434111-25434133 AATTGTATACTTAAAACGGGTGG - Intronic
928403193 2:30993983-30994005 AGCTGGACACTTAAATTTGGTGG + Intronic
929964825 2:46526410-46526432 AAATGTACACTTAAAAAGGCAGG - Intronic
933891482 2:86775445-86775467 AGATGTACTCTGAAGGCTGGTGG + Exonic
936860669 2:117014919-117014941 AATTGTACACTTAAAACAGGTGG - Intergenic
936968531 2:118151559-118151581 AGATGTACAGTTATAAATGGCGG + Intergenic
937586313 2:123555683-123555705 AAATGAACAATTAAAATTGGTGG + Intergenic
937782346 2:125853591-125853613 AGGTGTAAATGTAAAACTGGTGG - Intergenic
938234872 2:129697775-129697797 AGATGTACACTTCGAATGGGTGG + Intergenic
938318944 2:130349476-130349498 AGATCTACTTTAAAAACTGGTGG - Intergenic
938671456 2:133590188-133590210 AGACATTCACTTAAAAGTGGTGG + Intergenic
939498526 2:142951682-142951704 ATGTGTACACTTATAACTGGGGG - Intronic
939543162 2:143518139-143518161 AGTGGTACATTTAAAAATGGTGG + Intronic
942501503 2:176595481-176595503 ACAAGAACACTTAAAACTTGAGG - Intergenic
945641363 2:212435197-212435219 AGATGGGCACTGAAAACAGGAGG - Intronic
946890976 2:224276196-224276218 ATATGTGGAATTAAAACTGGGGG + Intergenic
1170111412 20:12808059-12808081 AATTATATACTTAAAACTGGAGG + Intergenic
1170862928 20:20125890-20125912 ATATATGCACTTAACACTGGAGG - Intronic
1172868348 20:38118196-38118218 AATTGTACACTTCAAACAGGCGG - Intronic
1174065422 20:47861193-47861215 AAATGTTCACTTAAAATTGGTGG + Intergenic
1176162461 20:63654648-63654670 AGAGGTACCCTTAAGACTGGAGG + Intergenic
1177361065 21:20071833-20071855 AGATCTAAACTAAAATCTGGTGG + Intergenic
1177888233 21:26772143-26772165 GGATGAAGACTTAAAACTTGGGG + Intergenic
1178045778 21:28693117-28693139 AAATGTACACTTTAAAAGGGGGG + Intergenic
1178311065 21:31530568-31530590 AGATCTACAAATAAAACTGTGGG + Intronic
1178542294 21:33463599-33463621 AATTGTACACTTTAAATTGGTGG + Intronic
1179635546 21:42706338-42706360 GGTTGTACACTTTAAAATGGTGG - Intronic
1181454486 22:23049096-23049118 ACATGTGCACCTAATACTGGAGG + Intergenic
952828343 3:37542629-37542651 AGATGTTCACTTGGAGCTGGTGG + Intronic
957905598 3:86550713-86550735 AGATGTTCATTTAAAACGGTAGG - Intergenic
958016576 3:87945229-87945251 AGCTGTACACCTAAATCGGGAGG + Intergenic
958774220 3:98462077-98462099 AAATGGACACTTGAAATTGGTGG + Intergenic
961583684 3:127904176-127904198 AGAGGCACACTAAAAGCTGGGGG - Intergenic
961851683 3:129825895-129825917 AGATGTACACTTAAAACTGGTGG + Intronic
962008290 3:131369839-131369861 AGATGGAAATTGAAAACTGGAGG + Intergenic
964080998 3:152756611-152756633 GGATGTACACTAAAACCTGAAGG - Intergenic
965474487 3:169138258-169138280 AAATGTACACTTAATACTTCAGG + Intronic
965719674 3:171647743-171647765 AACTGTACACTTAAAAATGGGGG - Intronic
968529333 4:1082358-1082380 AGATGCACACGTAAGACTGGGGG + Intronic
970043930 4:11828386-11828408 AGATGTAAACTAAAAAAAGGAGG + Intergenic
970634174 4:17989078-17989100 AGATATACTATTAAAGCTGGTGG - Intronic
974399867 4:61389540-61389562 AAATTTACACTTTAAACTGAAGG + Intronic
974465973 4:62256493-62256515 TGATGTACACATAAAACTTAAGG + Intergenic
974888756 4:67852722-67852744 AGATGTAGGGTTAACACTGGGGG + Intronic
976512448 4:85927456-85927478 AATTGTACATTTTAAACTGGGGG + Intronic
979122614 4:116922111-116922133 ATATATACACATAATACTGGAGG - Intergenic
979516521 4:121616209-121616231 ATTTGTAAACTTAAAACTTGTGG + Intergenic
983004722 4:162469691-162469713 AAATGTGCACTTAGACCTGGAGG - Intergenic
984376674 4:178939241-178939263 ATATGTATATTTATAACTGGTGG + Intergenic
985482500 5:124418-124440 AGATGTATTTTTAAAAATGGAGG - Intergenic
987490224 5:18570810-18570832 ATATGTACTGTTAAAACCGGGGG + Intergenic
989391358 5:40904039-40904061 TGATCTACACTTCAAACTTGTGG - Intergenic
989600704 5:43197901-43197923 ACTTGTACACTTAAACATGGAGG + Intronic
991190926 5:63872442-63872464 AAAGGTACACTTGAAATTGGAGG + Intergenic
992330145 5:75708579-75708601 AAATGTACATTTGAAATTGGGGG - Intronic
996198003 5:120633686-120633708 ATATATGCACCTAAAACTGGAGG + Intronic
996213419 5:120839439-120839461 AAATGTAAACTTAAAATAGGTGG + Intergenic
997076636 5:130686517-130686539 AGATGTTCACAGAAAACTAGAGG - Intergenic
998692294 5:144599703-144599725 GTATGTATACTTAAAAATGGAGG - Intergenic
1000044414 5:157510128-157510150 AGCTGTACACTTAAAATAGATGG - Intronic
1000645213 5:163753319-163753341 AACTGTACACTAAAACCTGGTGG - Intergenic
1002066788 5:176655931-176655953 AGAGGCTCACTTAAGACTGGTGG + Intronic
1007588470 6:43007189-43007211 AGAGGTTCACTGAAAACTGAGGG - Exonic
1008324220 6:50157744-50157766 AGATTCACACATAAAACTGATGG + Intergenic
1009728675 6:67569371-67569393 ATATGTACAGTTAAAATGGGTGG + Intergenic
1010149990 6:72719975-72719997 ATATGTACACTAAACTCTGGTGG + Intronic
1010461861 6:76122923-76122945 AGATGATCACTTAAAACTATTGG - Intergenic
1011285530 6:85718662-85718684 AGATGTACATTTAAAAATGGAGG + Intergenic
1012345517 6:98180588-98180610 ACATGCACACTCAAAACTAGAGG - Intergenic
1012882692 6:104810059-104810081 AGATGGACATTCAAATCTGGAGG + Intronic
1018562408 6:165115675-165115697 ACCTTTACAATTAAAACTGGTGG - Intergenic
1018760734 6:166892274-166892296 AGCTGTATACTTAAATCGGGTGG - Intronic
1019157750 6:170050448-170050470 AGATGTCCAACAAAAACTGGGGG - Intergenic
1020995654 7:15260479-15260501 ATATATGCACTTAACACTGGAGG + Intronic
1022946328 7:35288446-35288468 AAATGTACTTTTAAAACTTGTGG - Intergenic
1023367804 7:39481566-39481588 AAATGGTCACTTAAAACTAGAGG - Intronic
1024016585 7:45321739-45321761 AAATCTACAATTATAACTGGAGG - Intergenic
1026031912 7:66801586-66801608 AGCTAAACACTTAAAACTGAAGG - Intronic
1027839805 7:83294575-83294597 ATAGATACACTTAAAATTGGTGG - Intergenic
1027995839 7:85424277-85424299 TGAGGTACACAGAAAACTGGAGG - Intergenic
1031455672 7:121976369-121976391 ACAAGTAAAATTAAAACTGGTGG + Intronic
1031610041 7:123815215-123815237 AGATGTACACTTAACACTTTTGG + Intergenic
1032594306 7:133224223-133224245 AATTGTACACTTAAAAATGGTGG + Intergenic
1036443244 8:8799848-8799870 AGGTGTACATTTAAAACTGCAGG - Intronic
1036594570 8:10200409-10200431 AGATTTACTCTCAAAGCTGGAGG - Intronic
1041391975 8:57354965-57354987 AAATGTCTACTTAAAGCTGGAGG - Intergenic
1043983670 8:86669188-86669210 AGCTGTACACTTAATATTTGTGG + Intronic
1046018113 8:108630663-108630685 AGAAATTCACTCAAAACTGGAGG + Intronic
1047189912 8:122669040-122669062 AGACTTCCACTTAAAAGTGGTGG + Intergenic
1051379742 9:16443926-16443948 GATTGTACACTTAAAATTGGCGG + Intronic
1052736995 9:32352742-32352764 ATATGTACATATAAAACTAGAGG - Intergenic
1054817044 9:69485393-69485415 TGATATACTCTTAAAAATGGAGG + Intronic
1055421555 9:76148673-76148695 AGTTTTGCAATTAAAACTGGAGG - Intronic
1056464956 9:86844619-86844641 AAATGTATACTCAAAACTGTTGG + Intergenic
1056985239 9:91357943-91357965 ACATGCACATATAAAACTGGCGG + Intronic
1057583530 9:96308908-96308930 AACTGTACACTTAAAATTGCTGG + Intergenic
1058013947 9:100009042-100009064 AATTGTACACTTAAAAATGATGG - Intronic
1058599896 9:106658077-106658099 GGAAGTACAGTGAAAACTGGTGG - Intergenic
1188193085 X:27196405-27196427 AGAGGCACACTGAAAACTGTCGG + Intergenic
1189287830 X:39864799-39864821 ACTTGTACACTTAAGATTGGTGG + Intergenic
1192193323 X:69010795-69010817 AGATCTACCCTTAAAAATTGTGG - Intergenic
1192273151 X:69603148-69603170 AGATCTTGAATTAAAACTGGTGG + Intergenic
1194588204 X:95763697-95763719 AAATGTCCACTTAAGATTGGAGG + Intergenic
1196505670 X:116437995-116438017 AGAACCACACTTAAAACTGGAGG - Intronic
1197103497 X:122685372-122685394 AGATGAACACTTAAACATAGTGG - Intergenic
1198501872 X:137257808-137257830 AAATGGACTCTTAAAACTGTAGG + Intergenic
1198766203 X:140081519-140081541 AACTATACATTTAAAACTGGTGG - Intergenic
1199533333 X:148873784-148873806 AGATGTACAATTATGACTTGAGG - Intronic
1200313357 X:155103034-155103056 AGATGTATACTATAAACTAGTGG - Intronic