ID: 961861389

View in Genome Browser
Species Human (GRCh38)
Location 3:129919199-129919221
Sequence CCTGGTCCTGCTCTTTATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961861389_961861404 19 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861404 3:129919241-129919263 GAGAGGGTGGGAGTGCTGTGGGG No data
961861389_961861397 2 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861397 3:129919224-129919246 GCAAGAAGTGACCTGGGGAGAGG No data
961861389_961861399 6 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861399 3:129919228-129919250 GAAGTGACCTGGGGAGAGGGTGG No data
961861389_961861400 7 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861400 3:129919229-129919251 AAGTGACCTGGGGAGAGGGTGGG No data
961861389_961861396 -3 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861396 3:129919219-129919241 AGGAAGCAAGAAGTGACCTGGGG No data
961861389_961861403 18 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861403 3:129919240-129919262 GGAGAGGGTGGGAGTGCTGTGGG No data
961861389_961861402 17 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861402 3:129919239-129919261 GGGAGAGGGTGGGAGTGCTGTGG No data
961861389_961861394 -5 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861394 3:129919217-129919239 CCAGGAAGCAAGAAGTGACCTGG No data
961861389_961861395 -4 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861395 3:129919218-129919240 CAGGAAGCAAGAAGTGACCTGGG No data
961861389_961861398 3 Left 961861389 3:129919199-129919221 CCCCAATAAAGAGCAGGACCAGG No data
Right 961861398 3:129919225-129919247 CAAGAAGTGACCTGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961861389 Original CRISPR CCTGGTCCTGCTCTTTATTG GGG (reversed) Intergenic
No off target data available for this crispr