ID: 961862490

View in Genome Browser
Species Human (GRCh38)
Location 3:129927743-129927765
Sequence TCTCCTCTGTCGTGTCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961862490_961862495 -7 Left 961862490 3:129927743-129927765 CCGCCAGGACACGACAGAGGAGA No data
Right 961862495 3:129927759-129927781 GAGGAGACTCGCAGGATGGGTGG No data
961862490_961862496 -6 Left 961862490 3:129927743-129927765 CCGCCAGGACACGACAGAGGAGA No data
Right 961862496 3:129927760-129927782 AGGAGACTCGCAGGATGGGTGGG No data
961862490_961862494 -10 Left 961862490 3:129927743-129927765 CCGCCAGGACACGACAGAGGAGA No data
Right 961862494 3:129927756-129927778 ACAGAGGAGACTCGCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961862490 Original CRISPR TCTCCTCTGTCGTGTCCTGG CGG (reversed) Intergenic
No off target data available for this crispr