ID: 961864825

View in Genome Browser
Species Human (GRCh38)
Location 3:129945997-129946019
Sequence CTGTGAAATGGGAGGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961864825_961864834 -9 Left 961864825 3:129945997-129946019 CCATTCACCCTCCCATTTCACAG No data
Right 961864834 3:129946011-129946033 ATTTCACAGCCCGGGAAGGTGGG No data
961864825_961864836 0 Left 961864825 3:129945997-129946019 CCATTCACCCTCCCATTTCACAG No data
Right 961864836 3:129946020-129946042 CCCGGGAAGGTGGGCCCTTGAGG No data
961864825_961864838 1 Left 961864825 3:129945997-129946019 CCATTCACCCTCCCATTTCACAG No data
Right 961864838 3:129946021-129946043 CCGGGAAGGTGGGCCCTTGAGGG No data
961864825_961864833 -10 Left 961864825 3:129945997-129946019 CCATTCACCCTCCCATTTCACAG No data
Right 961864833 3:129946010-129946032 CATTTCACAGCCCGGGAAGGTGG No data
961864825_961864842 18 Left 961864825 3:129945997-129946019 CCATTCACCCTCCCATTTCACAG No data
Right 961864842 3:129946038-129946060 TGAGGGGAAAGAACCAGCTGTGG No data
961864825_961864839 2 Left 961864825 3:129945997-129946019 CCATTCACCCTCCCATTTCACAG No data
Right 961864839 3:129946022-129946044 CGGGAAGGTGGGCCCTTGAGGGG No data
961864825_961864843 29 Left 961864825 3:129945997-129946019 CCATTCACCCTCCCATTTCACAG No data
Right 961864843 3:129946049-129946071 AACCAGCTGTGGCAGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961864825 Original CRISPR CTGTGAAATGGGAGGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr