ID: 961865878

View in Genome Browser
Species Human (GRCh38)
Location 3:129953142-129953164
Sequence TAACTCTGCTTCTCAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961865878_961865880 1 Left 961865878 3:129953142-129953164 CCCATCTCTGAGAAGCAGAGTTA No data
Right 961865880 3:129953166-129953188 TCCTTGCATTCCCTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961865878 Original CRISPR TAACTCTGCTTCTCAGAGAT GGG (reversed) Intergenic