ID: 961869768

View in Genome Browser
Species Human (GRCh38)
Location 3:129978857-129978879
Sequence CTTTTGGGGCAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 623}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961869768 Original CRISPR CTTTTGGGGCAGAGGGAGGC AGG Intergenic
900207744 1:1438821-1438843 GGTTTGGGGCTAAGGGAGGCAGG + Intronic
900232416 1:1567083-1567105 CTTTTGTGGCTGTGGAAGGCCGG - Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900396626 1:2455690-2455712 CCTTTGCTGCAGATGGAGGCGGG + Intronic
900474431 1:2869557-2869579 GATTTAGGCCAGAGGGAGGCCGG - Intergenic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900978678 1:6034097-6034119 CCTTTAGCGCAGAGGGAGGCAGG - Intronic
901272272 1:7961665-7961687 AGTGTGGGGCTGAGGGAGGCCGG + Intronic
901690099 1:10967259-10967281 TGTTTGGAGCAGAGGGAGGGAGG - Intronic
902749283 1:18495899-18495921 GGTTAGGGGCAGAGGCAGGCCGG - Intergenic
903071452 1:20728875-20728897 CTGTTTGGGCTGAGTGAGGCAGG - Intronic
903217349 1:21850563-21850585 CTTGGGGGTCAGAGTGAGGCAGG - Intronic
903484053 1:23676532-23676554 CTTGTGGGGCAGGTGGAAGCAGG + Intergenic
903724164 1:25428876-25428898 GTGTTGGGGCAGAGGCAGGAAGG + Intronic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904681645 1:32233531-32233553 CTTTGGGAGCTGAGGCAGGCAGG - Intergenic
904764251 1:32830801-32830823 TTTTGGAGGCAGAGGCAGGCAGG + Intronic
905171019 1:36109597-36109619 CTTTTGAGACAGAGCCAGGCTGG + Intronic
905249120 1:36636712-36636734 CCTTTAGGGCAGGGGGAGGTGGG - Intergenic
906357890 1:45123108-45123130 CTCTTGTGGCAGAGGTAGGAAGG - Intronic
906561152 1:46757911-46757933 CTTTTGAGCCAGATGGTGGCAGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
908411303 1:63868387-63868409 AATATGAGGCAGAGGGAGGCTGG + Intronic
908550266 1:65201727-65201749 CTTTTGAAGGTGAGGGAGGCAGG + Intronic
908551869 1:65216464-65216486 ACTTTGGGGAAGCGGGAGGCAGG - Intronic
909401394 1:75235391-75235413 GTTTTGGGGGTGAGGTAGGCAGG + Intronic
911108748 1:94161191-94161213 CTTCTGGGACAGAGGGTGGAGGG + Intronic
911377580 1:97069744-97069766 CTTTGGGGGCAGTGGGGGGGGGG + Intergenic
911871856 1:103108664-103108686 ATTCTTGGGCTGAGGGAGGCGGG - Intergenic
912659787 1:111517063-111517085 CACTTGGGACAGAGGGAGGAAGG - Intronic
913938406 1:125079041-125079063 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
914339357 1:146745842-146745864 CTGTAGGGGCAGAGTAAGGCTGG - Intergenic
914905856 1:151743094-151743116 CTCTTGGTGGAGAGGGAGCCTGG - Intergenic
914991196 1:152501027-152501049 ATTTTTGGGAAGAGGGAGGAAGG - Intergenic
915463166 1:156081674-156081696 CTTTGGGGGCGGTGGGGGGCTGG + Exonic
915569688 1:156737819-156737841 CTTTTGGGTTGGAGGGTGGCAGG - Intronic
915841338 1:159215887-159215909 TTTCTGGGGCAGAGGGAGCCTGG - Intergenic
916123395 1:161549112-161549134 CTCCTGGGGCAGAGGAGGGCAGG - Intronic
916133287 1:161630470-161630492 CTCCTGGGGCAGAGGAGGGCAGG - Intronic
916757147 1:167783167-167783189 CTCTTAGGGCAGAGGAAGGTAGG + Intronic
916882406 1:169032663-169032685 CTGTTAGGGCAAATGGAGGCAGG - Intergenic
917533325 1:175856188-175856210 CTTTGGAGGCAGGTGGAGGCAGG + Intergenic
918113100 1:181475515-181475537 TTTTTGGGGCAGTGTGAAGCAGG + Intronic
918489196 1:185062128-185062150 CTTTTGAGGAAGAAAGAGGCAGG + Intronic
920198675 1:204245815-204245837 CCTTTGGGCCAGCAGGAGGCAGG + Intronic
920300503 1:204985888-204985910 CCTTCGGGACAGAGGCAGGCTGG - Intronic
920972779 1:210756891-210756913 AATTTGGGGGAGAGGGAAGCTGG + Intronic
922698758 1:227745766-227745788 CTCTGGGGGCAGAGGTAAGCAGG - Intronic
922769966 1:228176404-228176426 CATTTGGGGGAGAGGGAGGTGGG + Exonic
923403899 1:233642018-233642040 CTTTTGGTGGAGAGGTGGGCAGG + Intronic
924693248 1:246372746-246372768 TTTGTGGGGCCGAGGCAGGCGGG + Intronic
924769305 1:247064914-247064936 CTTGAGAGGCTGAGGGAGGCAGG - Intronic
1062911124 10:1213015-1213037 GCTTTGGGGAAGAGGGAGGGAGG + Intronic
1063731393 10:8700932-8700954 CTTTTGCAGCAGAGAAAGGCTGG + Intergenic
1064147406 10:12836480-12836502 CCTTGGGGGCAGAGAGAGTCAGG - Intergenic
1064378180 10:14816003-14816025 CTATTGGGGGAGACTGAGGCAGG - Intergenic
1064555037 10:16539452-16539474 CTTGTGGAACAGAGGAAGGCAGG + Intergenic
1065516224 10:26527050-26527072 CTTGGTGGGCTGAGGGAGGCTGG - Intronic
1066121211 10:32289411-32289433 CTTTTTTTGCAGGGGGAGGCGGG - Intronic
1066268747 10:33801359-33801381 TTTTGGAGGCAGAGGCAGGCAGG + Intergenic
1066950034 10:42108517-42108539 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1067101922 10:43340170-43340192 TTTTTGGGACAGAGGCAGGCAGG - Intergenic
1067450351 10:46378222-46378244 GTGCTGGGGCAGAGGGAAGCCGG + Intronic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067586894 10:47481541-47481563 GTGCTGGGGCAGAGGGAAGCCGG - Intronic
1067633950 10:47989308-47989330 GTGCTGGGGCAGAGGGAAGCCGG - Intergenic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1070150336 10:73801241-73801263 GTCTTGGACCAGAGGGAGGCAGG + Intronic
1070555537 10:77524935-77524957 CTGCTGGTGCTGAGGGAGGCCGG - Intronic
1072225044 10:93361105-93361127 GTTGTGGGGTAGAGGGAGGATGG + Intronic
1072378952 10:94847222-94847244 GTTTTGGGGTGGAGGGAGGGAGG - Intronic
1072786401 10:98286039-98286061 CTCTGGGGGAACAGGGAGGCAGG + Intergenic
1072837062 10:98726481-98726503 GTTGTGGGGCAGGGGGAGGGGGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073804479 10:107082587-107082609 CTTTGGAGGCTGAGTGAGGCAGG - Intronic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074780795 10:116800512-116800534 CTTTGTGGGGAGAGGGAGCCAGG + Intergenic
1075699336 10:124458916-124458938 CTTTTGGGCCAGAGCTAGCCAGG - Intergenic
1075794173 10:125107049-125107071 CTTGGGGGGTGGAGGGAGGCTGG + Intronic
1076058401 10:127393933-127393955 CTTTTGGGGCACACTCAGGCGGG - Intronic
1076408890 10:130231844-130231866 GTTTTGGGGTAAAGGGAGGCTGG + Intergenic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076633629 10:131868528-131868550 CTTGAAGGGCAGCGGGAGGCAGG - Intergenic
1076727827 10:132421620-132421642 CTGCTGGGGCAGAGGCTGGCTGG - Intergenic
1076814820 10:132909559-132909581 CTAGTGGGGCCCAGGGAGGCGGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077222743 11:1424718-1424740 CTGTTTGGACAGAGGGAGTCGGG + Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1080132240 11:28810314-28810336 CTTTTGGGGAACTGGAAGGCAGG + Intergenic
1082637906 11:55619279-55619301 GTTGTGGGGTAGGGGGAGGCAGG - Intergenic
1082951608 11:58821935-58821957 GTTGTGGGTTAGAGGGAGGCGGG + Intergenic
1083226444 11:61287822-61287844 CTTTTGAGGCAGCAGGAGACAGG + Intronic
1083299455 11:61732721-61732743 CCTGTGGGGCAGAGAGAGGCAGG + Intronic
1083445609 11:62706337-62706359 CTTTTGTAGCCGTGGGAGGCGGG + Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1084207660 11:67605363-67605385 CCTTTGGGGCAGAAGAAGGGGGG - Intronic
1084380814 11:68811535-68811557 CTTCTGGGGCAGGGGGTGGGGGG + Intronic
1085729191 11:78982113-78982135 CTTGTGGGGCAGGGAGAGGGTGG + Intronic
1085777541 11:79380047-79380069 CTGGTGGGGCAGAGAGAAGCAGG + Intronic
1087161046 11:94948416-94948438 GTTTTGAAGCAGAGGGAGGGAGG - Intergenic
1087850128 11:103018534-103018556 GTTGTGGGGTAGGGGGAGGCGGG - Intergenic
1088850299 11:113698624-113698646 CATTTGGGGCAGAGTGAGCCAGG - Intronic
1088986413 11:114913267-114913289 ATTTGTGGGCAGAGAGAGGCAGG + Intergenic
1089346574 11:117795403-117795425 CTGCGGGGGCGGAGGGAGGCAGG + Intronic
1089713606 11:120336106-120336128 CCTACGGGGCAGAGGGAGGTGGG - Intergenic
1090252269 11:125259986-125260008 CTTGTTGGGGAGAGTGAGGCAGG - Intronic
1090266356 11:125355675-125355697 TTCTTGGGGCAGTGGGAGGAGGG - Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1091741040 12:2960219-2960241 ACTTTGGGGGAAAGGGAGGCCGG + Intronic
1092907164 12:13111907-13111929 CTTTTGGGTCAGGGGGTTGCAGG - Intronic
1093389365 12:18599494-18599516 GTTGTGGGGTAGGGGGAGGCGGG + Intronic
1093410952 12:18865901-18865923 TTTTTGGGTCATAGTGAGGCAGG + Intergenic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1093608590 12:21126220-21126242 TTTTTGAGGCAAAGGAAGGCTGG + Exonic
1093878506 12:24377016-24377038 CGTTTAGGGCAGAGGATGGCTGG - Intergenic
1093878659 12:24378894-24378916 GGTTTGGGGCAGAGGATGGCTGG - Intergenic
1094616328 12:32039436-32039458 GTTTTGGGGTAGAGGGAGTATGG + Intergenic
1095858548 12:46889147-46889169 GTTGTGGGGTAGGGGGAGGCGGG - Intergenic
1096260391 12:50086357-50086379 ATCCTGGGGCAGAGGGAGGGAGG + Intronic
1096262065 12:50099193-50099215 TTTGTGGGGCAAAGGGAAGCTGG - Exonic
1096750930 12:53758376-53758398 ATTTTTGGGGACAGGGAGGCAGG + Intergenic
1096995438 12:55835164-55835186 CTTATGGGGAAGGGGGAGGAAGG + Intergenic
1097572818 12:61355443-61355465 CTTTGGGGACCCAGGGAGGCAGG + Intergenic
1098383924 12:69898445-69898467 CATCTGGGGCAGAGGCAGGTGGG + Intronic
1098482683 12:70984199-70984221 TTTTTGGGGTAGGGGAAGGCTGG - Intergenic
1098875668 12:75864282-75864304 CTTTTGGGGTTAAGGGAGTCTGG + Intergenic
1099640788 12:85280664-85280686 CTTTGGGGGCGGAGGGCGGAGGG + Intronic
1100301900 12:93315308-93315330 CATTGGGTGCTGAGGGAGGCGGG - Intergenic
1100365308 12:93915124-93915146 CTTTTGGGGACGATGAAGGCAGG + Intergenic
1100685969 12:96986071-96986093 CCTTTGGGGAAGAGGGAGGAAGG + Intergenic
1100906283 12:99303777-99303799 CTTGTGGGGAAGAGTGAGGTGGG - Intronic
1100981641 12:100166938-100166960 GCTTTGGGGCAGAGGGAGAGAGG - Intergenic
1101052809 12:100881130-100881152 GTTTTGGGGTGGGGGGAGGCGGG + Intronic
1101967488 12:109291441-109291463 ATTGAGGGGCAGAGAGAGGCGGG + Intronic
1102640801 12:114364878-114364900 CTTTGGGGACAGAGAGATGCGGG - Intronic
1105233880 13:18527288-18527310 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1105705759 13:22966573-22966595 CTTATGGGTGAGAGGCAGGCAGG - Intergenic
1105858663 13:24391558-24391580 CTTATGGGTGAGAGGCAGGCAGG - Intergenic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1106129952 13:26931909-26931931 CTTTAAGGACAGAGGGAAGCTGG - Intergenic
1106703817 13:32259175-32259197 CATTTGGGGGAGAGGAAGGATGG + Intronic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108544673 13:51480852-51480874 TTATTTGGGCAGAGGGAGGGAGG + Intergenic
1109509705 13:63353851-63353873 GTTGTGGGGTAGAGGGAGGGGGG - Intergenic
1110494102 13:76145801-76145823 AATGTGGGGCAGAGGGAGCCAGG + Intergenic
1113786960 13:113006961-113006983 CCCTTGGGGGAGAGGGTGGCAGG + Intronic
1114491009 14:23102021-23102043 CTCTGGGGGAAGTGGGAGGCTGG - Intergenic
1114994622 14:28332405-28332427 GTTTTGGGGTGGGGGGAGGCAGG + Intergenic
1115029298 14:28774981-28775003 GTTGTTGGCCAGAGGGAGGCCGG + Intronic
1115525582 14:34277258-34277280 CTTTTTAGGGAGTGGGAGGCAGG - Intronic
1115688491 14:35821206-35821228 ATTTTAGGGAAGAGGGAAGCAGG + Intergenic
1116152293 14:41156101-41156123 CTTGTGGGGCCGAGGCAGGCGGG + Intergenic
1117381371 14:55167010-55167032 CTTTGGGGGCCGAGGCAGGCAGG + Intronic
1118888518 14:69887412-69887434 TTTTTGGGGGAGAGGGAGGATGG + Intronic
1119074364 14:71621198-71621220 CTGTTGGGTCAAAAGGAGGCAGG - Intronic
1119659137 14:76438065-76438087 CTCTTGGGGGACAGGCAGGCTGG + Intronic
1119976209 14:79027026-79027048 TTTTTGGGGTAGTGGGAGGTGGG - Intronic
1120044435 14:79790550-79790572 CTTTTGGGGATGAAGGAGGGAGG - Intronic
1120800105 14:88678280-88678302 CTCTTGGGGGACAGGGAGGAGGG + Intronic
1121786589 14:96666149-96666171 CTCCTGGGGGAGAGGGAGACTGG - Intergenic
1122739898 14:103866271-103866293 CTTCTTGGGACGAGGGAGGCAGG - Intergenic
1122891750 14:104735247-104735269 CTGGTGGGGCAGGTGGAGGCTGG - Intronic
1122896537 14:104760324-104760346 TGTTTGGGGCAGAGGGTGGGTGG + Intronic
1125909232 15:43421281-43421303 CCTTTGGGGCAGCAGGAAGCTGG + Intronic
1126131220 15:45343430-45343452 TTTGTGAGGCAGAGGCAGGCAGG - Intergenic
1126543603 15:49847875-49847897 CTTTTGGGGGAGAAGGAGAAAGG - Intergenic
1126876378 15:53045945-53045967 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1127302256 15:57666485-57666507 GATTTGGGGCAGAGGGAGGAGGG - Intronic
1127385330 15:58462207-58462229 CTTTGAAGGCAGAGAGAGGCTGG + Intronic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1129242364 15:74259192-74259214 CTTTGGGGGGACAGGGAGGGGGG + Intronic
1129373543 15:75113137-75113159 CTTCTGGCTCAGATGGAGGCAGG - Intronic
1129766074 15:78168672-78168694 CTCTTGATGCAAAGGGAGGCAGG - Exonic
1129785429 15:78306918-78306940 CTTGTGGGGCAGAGTGAGGGTGG - Intergenic
1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG + Intronic
1130890951 15:88133444-88133466 CTTCTGGGGCCTAGGGAGGGGGG - Intronic
1131202945 15:90416165-90416187 GTTGTGGGGTAGGGGGAGGCGGG - Intronic
1131553684 15:93378713-93378735 GTTTTGGTGCTGAGGGAGCCTGG + Intergenic
1132946551 16:2534746-2534768 CTTGTGGGCCAGAGGCAGCCAGG + Intergenic
1132969158 16:2676880-2676902 CTTGTGGGCCAGAAGAAGGCGGG - Intergenic
1133041864 16:3065180-3065202 CTTCTGGATCAGAAGGAGGCAGG - Intergenic
1133157482 16:3885286-3885308 TATTTGGGGCAGTGGGAAGCAGG + Intergenic
1133532395 16:6667111-6667133 GGGTTGGGGGAGAGGGAGGCAGG + Intronic
1133768121 16:8851834-8851856 CTGTTGGGGCAGTGGGAGTGAGG - Intergenic
1133816252 16:9199533-9199555 CTCCTGGGGCAGAGGCAGGAAGG - Intergenic
1133890937 16:9877859-9877881 GAGTTGGGGGAGAGGGAGGCAGG - Intronic
1135335908 16:21600226-21600248 CTTTGGGGCCAGAGCGTGGCTGG + Intronic
1135498531 16:22973760-22973782 CTCTTCAGCCAGAGGGAGGCTGG - Intergenic
1136043144 16:27596048-27596070 CTCTGGGGGCAGTGGGAGCCAGG + Intronic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136236914 16:28919944-28919966 CTGGTGGGGGAGAGGGAGGGTGG + Intronic
1136935429 16:34459021-34459043 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1136938264 16:34496656-34496678 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1136949108 16:34693482-34693504 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1136961554 16:34851901-34851923 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1136964389 16:34889549-34889571 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1137010511 16:35315901-35315923 GATTTGGGGAAGAGTGAGGCTGG + Intergenic
1137093527 16:36224015-36224037 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1137218508 16:46424561-46424583 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1137759306 16:50927681-50927703 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1137775134 16:51047933-51047955 CTGAGGGGGCTGAGGGAGGCTGG + Intergenic
1138079106 16:54071940-54071962 CGTTAGGGGCAAAGGAAGGCCGG + Intronic
1138407494 16:56809173-56809195 CCTTTGTGCCAGAGGGAGCCAGG + Intronic
1138856284 16:60697262-60697284 CTTTTGGGGCGGGGAGAGGATGG - Intergenic
1139075123 16:63436776-63436798 CTTTTGGTGCATTGGGAGGTGGG + Intergenic
1139835001 16:69831042-69831064 GATTGAGGGCAGAGGGAGGCAGG + Intronic
1139994918 16:70971507-70971529 CTGTAGGGGCAGAGTAAGGCTGG + Intronic
1140203607 16:72914746-72914768 CTTTGGGGGCTGAGGCAGGCAGG + Intronic
1140346890 16:74221886-74221908 CTATTCTGGCAGATGGAGGCTGG + Intergenic
1140376079 16:74446438-74446460 CTTATGGGGCAGAGTGGAGCTGG + Intergenic
1140538689 16:75734977-75734999 GTTTTGGGGTAGGGGGAGGGGGG - Intronic
1141543854 16:84749424-84749446 CTTTTGGGAAAGAGGGAGTAGGG + Intronic
1142114326 16:88348512-88348534 GTTCTGGGGCTGAGGGTGGCGGG - Intergenic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1142663244 17:1445884-1445906 CTTTTGGGACAGTGGTTGGCAGG + Intronic
1142742715 17:1940523-1940545 CTCCTTGGGCAGATGGAGGCAGG - Intronic
1142822219 17:2479272-2479294 CTTGTGGGGCCGAGGCAGGAGGG - Intronic
1143302577 17:5921954-5921976 CATTTGAGGCAGAGGGCTGCTGG + Intronic
1143729665 17:8874058-8874080 CTCTGGGGGCAAAGTGAGGCAGG - Intergenic
1144383824 17:14730277-14730299 CTTTTGGGAGAGAGGGTGGAGGG - Intergenic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1144956530 17:19021524-19021546 CTTTTGAGGGAGGGGCAGGCAGG + Exonic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1146279878 17:31538109-31538131 CTTTTGGGGCAGAAGCAGGTTGG - Exonic
1146824802 17:36012947-36012969 CTTGTGGGGCTGAGGTAGGTGGG + Intergenic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147789009 17:43001327-43001349 CTAAAGGGGCAGAGAGAGGCCGG + Intronic
1147889186 17:43704962-43704984 CTTGCGGGGTAGAGGGAGGCTGG - Intergenic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148283753 17:46370063-46370085 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1148305971 17:46587980-46588002 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1149038465 17:52159330-52159352 CTTTTCGGGAGGAGGGAGGCAGG - Intronic
1149376022 17:56044928-56044950 TTTTTGGGGTAGTGGGAGGCAGG + Intergenic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150591804 17:66569323-66569345 CTTTGGAGGCCGAGGCAGGCGGG + Intronic
1150628580 17:66859672-66859694 CTTTTGGGGTGAAGGGAGGAAGG - Intronic
1151457264 17:74233472-74233494 CCTTGGGGTCAGCGGGAGGCTGG + Intronic
1151934933 17:77255706-77255728 CTTTCAGGGCAGAGGCAGGGTGG + Intergenic
1152326884 17:79646814-79646836 GTCATGGGGCAGAGGGTGGCTGG - Intergenic
1203184093 17_KI270729v1_random:95565-95587 CTTTTAGGGCATAGGGAGGTTGG + Intergenic
1153866096 18:9270611-9270633 GTTGTGGGGTGGAGGGAGGCGGG + Intronic
1154162368 18:11989929-11989951 CTTTAGGGGTGGAGGAAGGCAGG + Intronic
1154515662 18:15162587-15162609 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1156466532 18:37351106-37351128 CTGGTGGGGGAGAGGGGGGCTGG + Intronic
1156702651 18:39842942-39842964 GTTTTGCGGGGGAGGGAGGCGGG + Intergenic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1157856582 18:51110319-51110341 CTTGTGGGGCGGAGGGAGCTGGG + Intergenic
1158007206 18:52686323-52686345 CTGTTGGAACAGAGGTAGGCTGG - Intronic
1158727212 18:59984455-59984477 CTTTTGGGGCGGGGGGGGGGGGG - Intergenic
1159120005 18:64157859-64157881 GTTTTGGGAAAGAGGGAGGGTGG + Intergenic
1159131937 18:64289392-64289414 GTTTTGGGGTAGGGGGAGGGGGG - Intergenic
1159837624 18:73358016-73358038 CGTTTGGGTCAGCTGGAGGCTGG + Intergenic
1160201668 18:76801619-76801641 CTTTGGGGGGCGAGGGAGGCAGG - Intronic
1160279189 18:77471285-77471307 CTTCTCGTGCAGAGGGAGGGTGG + Intergenic
1160340032 18:78081904-78081926 CCTGTGAGGCAGTGGGAGGCGGG + Intergenic
1160493199 18:79354950-79354972 CTTTTTGGGGAGGGGGAGGTGGG - Intronic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1161236941 19:3202893-3202915 TTTCTGGGGCAGAGGGAAACTGG + Intronic
1161393093 19:4031500-4031522 CTTTGAGGGAAGAGGGAGGTGGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162247100 19:9410552-9410574 CTTTTGGGGCAGTGGATTGCAGG - Intergenic
1162380941 19:10331443-10331465 CTTTGGAGGCTGAGGCAGGCGGG + Intronic
1162417602 19:10547351-10547373 GTTGTGGGGCAGAGGGACACTGG + Intronic
1162558922 19:11404601-11404623 GTTTTGGGGATGATGGAGGCTGG + Intronic
1162774484 19:12970921-12970943 CTTGGGGGGCCGAGGCAGGCGGG - Intronic
1163000205 19:14362418-14362440 TTTGTGGGGCAGAGGCAGGAGGG + Intergenic
1163068613 19:14819038-14819060 GTTATGGGGCAGGGGGAGGGGGG - Intronic
1163178541 19:15582993-15583015 ATTTAGGGTCAGAGGGAGGTTGG + Intergenic
1163290527 19:16376669-16376691 CTGTTGGGGGTGAGGGTGGCAGG - Intronic
1163374309 19:16921090-16921112 CTCCTGGGGCTGGGGGAGGCTGG + Intronic
1163430996 19:17267565-17267587 CTCTTGGGGCAAAGGGAGCTGGG - Intronic
1164048023 19:21559492-21559514 CTTTGGAGGCAGAGGTGGGCGGG - Intergenic
1164061419 19:21678435-21678457 CTGCTGGTGCAGAGCGAGGCTGG - Intergenic
1164061463 19:21679173-21679195 CTACTAGAGCAGAGGGAGGCTGG + Intergenic
1164064801 19:21706598-21706620 CTACTGGTGCAGAGGGAGGCTGG - Intergenic
1164089884 19:21940608-21940630 CTCCTGACGCAGAGGGAGGCTGG + Intronic
1164109299 19:22140184-22140206 CTCCTGATGCAGAGGGAGGCTGG + Intergenic
1164169212 19:22709485-22709507 CTCCCGGTGCAGAGGGAGGCTGG - Intergenic
1165076538 19:33282669-33282691 CTTTTAGGCAAGAGTGAGGCTGG + Intergenic
1165521112 19:36314706-36314728 CTTATGGGGATGAAGGAGGCAGG + Intergenic
1165622956 19:37263882-37263904 CTTCTGGGGATGAAGGAGGCAGG - Intergenic
1165634639 19:37330499-37330521 CTTATGGGGATGAAGGAGGCAGG - Intronic
1165834029 19:38743703-38743725 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166035712 19:40166787-40166809 CTTTTGGGGGGGAGGGGGACAGG - Intergenic
1166382669 19:42362901-42362923 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1166388645 19:42396693-42396715 CTCCTGGGTCAGAGGGAGGAGGG - Intergenic
1166523938 19:43499327-43499349 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1166531566 19:43546354-43546376 CTTCTGGGTCTGAGGGAGGAGGG - Intronic
1166568692 19:43780317-43780339 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1166568793 19:43780612-43780634 CTCTTGGGTCTGAGGGAGGGGGG - Intronic
1166683529 19:44781872-44781894 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1166695805 19:44851027-44851049 CTTCTGGGTCTGAGGGAGGCGGG - Intronic
1166807788 19:45497245-45497267 CTTTAGGGGAAGAGGGAAGGAGG + Intronic
1167105879 19:47429712-47429734 CTTTGGGGGCAAAGCCAGGCTGG + Exonic
1167248748 19:48390080-48390102 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1167248774 19:48390152-48390174 CTTTTGGGTCTGAGGGAGGAAGG - Intronic
1167264804 19:48478203-48478225 CTCCTGGGGCTGAGGGAGGTGGG + Intronic
1167265812 19:48482769-48482791 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1167266100 19:48483505-48483527 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1167298328 19:48664507-48664529 CTCCTGGGGCTGAGGGAGGAGGG - Intronic
1167327670 19:48835566-48835588 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1167426955 19:49434370-49434392 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1167456519 19:49599197-49599219 TTTTGGGGGCTGAGGGAGGATGG + Intronic
1167460320 19:49621228-49621250 CTCTTGGGTCAGAGAGAGGAGGG + Intronic
1167474492 19:49691995-49692017 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1167474518 19:49692068-49692090 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1167489298 19:49782384-49782406 CTTGTGGGTCTGAGGGAGGAGGG + Intronic
1167560903 19:50226096-50226118 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167560931 19:50226170-50226192 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167561015 19:50226393-50226415 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167561044 19:50226467-50226489 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167597398 19:50434978-50435000 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1167669118 19:50839397-50839419 CTCTTGGGTCTGAGGGAGGAGGG + Intergenic
1167691026 19:50983581-50983603 ATTTTGGGTCTGAGGGAGGAGGG - Intronic
1167705544 19:51079166-51079188 CTTCTGGGTCTGAGGGAGGAGGG - Intronic
1167741475 19:51326990-51327012 CTTACGGGCCTGAGGGAGGCGGG + Intronic
1167743357 19:51337642-51337664 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1167798661 19:51726758-51726780 CTTCTGGGTCTGAGGGAGGTGGG - Intergenic
1167798686 19:51726831-51726853 CTCCTGGGTCTGAGGGAGGCGGG - Intergenic
1167799444 19:51730567-51730589 CTTCTGGGTCTGAGGGAGGAGGG + Intergenic
1168077802 19:53990687-53990709 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077915 19:53990981-53991003 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1168095927 19:54114857-54114879 CTTCTGGGTCTGAGGGAGGAGGG - Intronic
1168106605 19:54169376-54169398 TTTTTGGGTCTGAGGGAGGAGGG - Intronic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168236052 19:55063673-55063695 CTTCTGGGTCCGAGGGAGGAGGG + Intronic
1168237324 19:55071540-55071562 CTCTTGGGTCTGAGGGAGGAGGG - Intergenic
1168237336 19:55071576-55071598 CCTTTGGGTCTGAGGGAGGAGGG - Intergenic
1168238153 19:55076255-55076277 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1168238696 19:55078747-55078769 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1168246158 19:55114046-55114068 CTTCTGGGTCTTAGGGAGGCGGG - Intronic
1168252228 19:55147496-55147518 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1168254483 19:55158097-55158119 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1168254507 19:55158170-55158192 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1168255269 19:55161480-55161502 CTCCTGGGTCTGAGGGAGGCTGG - Intronic
1168277331 19:55285048-55285070 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1168277344 19:55285086-55285108 CTTTTGGGTTTGAGGGAGGAGGG + Intronic
1168306268 19:55437934-55437956 CTCCTGGGTCTGAGGGAGGCGGG - Intronic
1168327727 19:55546680-55546702 CTCTTGGGTCTGAGGGAGGTGGG - Intergenic
1168460945 19:56557382-56557404 ATTTTGGGGAAGAGTGAGGCAGG - Intergenic
1168593548 19:57655716-57655738 CTTATAGGGAAGAGGGTGGCTGG - Intergenic
1168668867 19:58226322-58226344 TTTTTGAGTCAGAGGCAGGCTGG + Intergenic
925846894 2:8042899-8042921 CTTCAGGGGAAGAGAGAGGCTGG + Intergenic
926076980 2:9950499-9950521 CTGGTGGGGCACAGGGAGGCGGG - Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
928126292 2:28618805-28618827 GCTTTGGGGCAGAGGGAGCCCGG + Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928196833 2:29222294-29222316 CTTTGGGGGCAGAGGGGAGTTGG + Intronic
928965943 2:36975464-36975486 CTTGTGAGGCTGAGGCAGGCTGG + Intronic
929395684 2:41519617-41519639 ATTTTGGTGCAGAGGTAGGTAGG - Intergenic
929631388 2:43466333-43466355 CTGTAGGGGCAAAGGGAGCCAGG - Intronic
929706419 2:44217017-44217039 CCTTTGGAGATGAGGGAGGCGGG + Intronic
930226537 2:48799915-48799937 TTTTGGGAGGAGAGGGAGGCTGG + Intergenic
930755317 2:54967223-54967245 CTTTTGGGGGTGAGGGTGGGAGG + Intronic
932070367 2:68613794-68613816 CTTTTGGGGTGGGGGGAGGGGGG - Intronic
932414119 2:71563629-71563651 CTCTTGGGGCTGAGGAAGGCGGG + Intronic
932874184 2:75433282-75433304 CTCTTGGGGTAGAGGAAGGGTGG + Intergenic
933360500 2:81276784-81276806 TTGCTGGGGCAGAGGGAAGCAGG + Intergenic
934332050 2:92077595-92077617 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
934746953 2:96765556-96765578 CTTGTGGGGCAGAAGGACTCTGG - Intronic
934752044 2:96799753-96799775 TGGCTGGGGCAGAGGGAGGCTGG + Intronic
935203843 2:100881176-100881198 CTGTTGGGGCCGAGGTAGGATGG - Intronic
935676265 2:105597224-105597246 CTGCTGGGGAAGAGAGAGGCAGG + Intergenic
935853519 2:107249026-107249048 CTTCTGGGGCACATAGAGGCAGG + Intergenic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936885747 2:117308779-117308801 CTCCTGGGGCAGAGGCAGGGAGG - Intergenic
937206686 2:120241152-120241174 CTTCTGGGAGAGTGGGAGGCAGG - Intronic
937273684 2:120671023-120671045 CTCTGGGGGCAGGGGGAGGAGGG + Intergenic
937277718 2:120696072-120696094 ATTTTGTGGCAGAGGAAGCCAGG + Intergenic
937635808 2:124154187-124154209 CTTTTGAGCCAGAAGGAGCCTGG + Intronic
938192340 2:129295125-129295147 GTAGTGGGGCAGAGGGAGGAGGG + Intergenic
942160531 2:173181272-173181294 CTTGTGAGGCAGAGGATGGCAGG + Intronic
943266286 2:185737404-185737426 TTTTTGGGGTAGATGGTGGCAGG + Intergenic
943951629 2:194136368-194136390 CTTTTGAGCCAGGGTGAGGCAGG + Intergenic
945278854 2:208016399-208016421 CTTTGGGGGGAGATGGTGGCAGG + Intronic
946319679 2:218944895-218944917 GTTTTTGGGAAGAGAGAGGCAGG + Intergenic
947013461 2:225591244-225591266 CTTATGGGGCACTGGGAGGATGG + Intronic
947089493 2:226494244-226494266 CTATTGGGACAAAGGGAGACCGG - Intergenic
947313829 2:228832997-228833019 GTTGTGGGGTAGAGGGAGGGGGG + Intergenic
947442445 2:230134937-230134959 ATTTTGGGCCAGAAGGAAGCAGG + Intergenic
947544452 2:231001155-231001177 CTTTTTGGGAAGAGGAAGGAAGG - Intronic
947592835 2:231395301-231395323 CTTTGGGGCCAGAGGCAGACAGG - Intergenic
948057362 2:235018637-235018659 CTTCTGGGAGAAAGGGAGGCAGG + Intronic
948205562 2:236161115-236161137 CCGCTGGGGCAGAGGGAGGGTGG - Intergenic
948467563 2:238159463-238159485 CTTTTGGGACAGAAGGAAGTTGG + Intronic
948671113 2:239569548-239569570 GGTGTGGGGCAGGGGGAGGCGGG - Intergenic
948695151 2:239729521-239729543 CGGGTGGGGCAGAGGGAGGCGGG + Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169190910 20:3658803-3658825 CTTTGGAGGAAGAAGGAGGCAGG + Intergenic
1169516905 20:6326853-6326875 CTTTTGGGGAAGAGTGGGGGGGG - Intergenic
1169831223 20:9827613-9827635 ATTTTGGGGGAGGGGGAGGGTGG + Intronic
1170295138 20:14816180-14816202 GTTGCGGGGCAGAGGGAGGATGG + Intronic
1170808011 20:19650655-19650677 CTTTAGGGGAAGATGGGGGCTGG - Intronic
1170960408 20:21020387-21020409 GTTTGCGGGCAGAGGGAAGCCGG - Intergenic
1171145130 20:22774782-22774804 TTCATGGAGCAGAGGGAGGCCGG + Intergenic
1171208671 20:23300601-23300623 CTCATCGGGCAGTGGGAGGCGGG + Intergenic
1172028908 20:31968155-31968177 ATGTTGGCGGAGAGGGAGGCGGG - Exonic
1172437046 20:34936693-34936715 ATTTTGGGGAAGAGGGTGGCAGG + Intronic
1172603268 20:36197997-36198019 CCCTTGGGGGAGGGGGAGGCGGG - Exonic
1172865161 20:38090335-38090357 CTTTTGGGGCAGATGCAGCTGGG - Exonic
1173222028 20:41138409-41138431 CCTCTGGGGGAGAGGGAGGAAGG + Intronic
1173688296 20:44939336-44939358 CTTTTGTGTCTGAGGGAGGTGGG + Intronic
1173835068 20:46119430-46119452 CTCTTAGGGAACAGGGAGGCAGG + Intronic
1173959503 20:47060106-47060128 CTTATGGGGCAGAGGTTGGCTGG + Intronic
1173986584 20:47266270-47266292 TTTTTGGGGGGGAGGGGGGCGGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174053597 20:47784155-47784177 CTTTTGGGGCAGAGAAGGGGAGG - Intronic
1174200456 20:48803296-48803318 ATTTTGGGTCTGAGGGAGGAAGG - Intronic
1174863480 20:54114177-54114199 CTCTTGGGGGAGAGTGGGGCAGG + Intergenic
1175100189 20:56573916-56573938 CCTCTGAAGCAGAGGGAGGCAGG - Intergenic
1175141389 20:56862744-56862766 CTTTTGGGGAGAAGGGAGCCAGG - Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176777865 21:13155565-13155587 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1177975479 21:27844572-27844594 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1178208390 21:30497609-30497631 CTTTGGGGGTCGAGGGAGGAGGG - Intergenic
1178351702 21:31876217-31876239 CTTTGGGTGGAGAAGGAGGCAGG + Intronic
1180170339 21:46055091-46055113 TGTGCGGGGCAGAGGGAGGCAGG - Intergenic
1180525643 22:16256992-16257014 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1180527226 22:16303730-16303752 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1181236133 22:21448673-21448695 CTTTTGGGGGTGAGGGAGCTTGG + Exonic
1182362020 22:29752283-29752305 CATTTGGGTCAGAGTGTGGCTGG - Intronic
1182368687 22:29795988-29796010 CTTTTGGTGCAGGGAGAGGCAGG + Intronic
1183190660 22:36320171-36320193 AGTGTGGGGCAGAGGAAGGCTGG - Intronic
1183309335 22:37101022-37101044 GTTGGGGGGCAGAGGGAGCCAGG + Intronic
1183457109 22:37928878-37928900 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1183696941 22:39428854-39428876 CTGATGGGGCAGAGGCATGCAGG - Intronic
1184172738 22:42769283-42769305 CTTGAGGGGCAGAGGGTGGGGGG + Intergenic
1184325739 22:43782935-43782957 CTGTTGGGGCAGGGGGAGGCAGG - Intronic
1184384827 22:44168028-44168050 CTTTTGGATCACAGGGAGTCAGG + Intronic
1184417358 22:44359999-44360021 CTTTTGGGGGACAAGGAGGGCGG + Intergenic
1185404315 22:50638085-50638107 CTTTTGTGGAAAAGGGAGACTGG + Intergenic
1203247493 22_KI270733v1_random:85030-85052 CTTCTGGGGGGGAGGGAGGTGGG - Intergenic
1203322728 22_KI270737v1_random:83923-83945 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
949207626 3:1459206-1459228 CTTGTGGGGTAGGGGGAGGGGGG - Intergenic
949976891 3:9468843-9468865 CGTTTGGGGGAGGGGGTGGCTGG + Intronic
950108176 3:10401502-10401524 CTTTTAGGGCAGAGTGAGGAGGG + Intronic
950382905 3:12632415-12632437 CTTTTGGGGCAGGGAGAAGTAGG + Intronic
950433578 3:12965800-12965822 CTTTCAGCTCAGAGGGAGGCGGG + Intronic
950454767 3:13086074-13086096 GTTTTGGGGCAGAGTGAGGTAGG + Intergenic
950574155 3:13821167-13821189 AATTGGGGGCAGAGTGAGGCAGG + Intronic
950851851 3:16069747-16069769 CTCTAGGGGCAGTGGGAGGGTGG + Intergenic
951666449 3:25129828-25129850 CTTTTGGTGCAGAGTGATGGAGG + Intergenic
951863281 3:27277649-27277671 CTTTTGGTGCAGAGTTAAGCAGG - Intronic
952953956 3:38545154-38545176 CTTATGGGCCAGAGGTGGGCAGG + Intergenic
953142983 3:40246648-40246670 GTTTTGGGGGACAGGGAGGAGGG + Intronic
953508348 3:43508790-43508812 GTTGTGGGGTAGGGGGAGGCGGG + Intronic
953549755 3:43892592-43892614 CTTGTGGGGCAGACGGTGGCAGG + Intergenic
954003267 3:47574155-47574177 CTTGTGAGGCAGTGAGAGGCTGG + Intronic
954304117 3:49716594-49716616 GTTTTGAGGCAGAGGGAAGGTGG + Intronic
954412067 3:50375101-50375123 CTTGTGGGTCAGAGGGAGGTTGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
954776774 3:53026591-53026613 CTGTGGGGGCACAGGGAGGGAGG - Intronic
955193894 3:56787223-56787245 ATGTTGGGGCAGAGGGAAGGAGG - Intronic
955444512 3:58995202-58995224 GTGATGGGGCAGAGGAAGGCAGG - Intronic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
957437396 3:80196369-80196391 GTTGTGGGGTAGGGGGAGGCAGG - Intergenic
960699703 3:120428057-120428079 CTTCTGAGGTAGAGGGAGACAGG + Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961604932 3:128086532-128086554 CATTTGGGGCAAAGGTGGGCAGG + Intronic
961677689 3:128577684-128577706 CTGTTGGGGCAGAGGGCAGGTGG - Intergenic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
962285885 3:134085245-134085267 CCAATGGGGCAGAGGAAGGCAGG - Intronic
962491401 3:135897194-135897216 CTTTTTGGGGGGTGGGAGGCAGG - Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965066094 3:163850629-163850651 CTTGTGGGGCAGGGGGTGGAGGG + Intergenic
967731144 3:192908062-192908084 CTTATGTGGCAGAGGGATGTAGG - Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969483298 4:7458195-7458217 CCTGTGGGGCGGGGGGAGGCGGG + Intronic
969527444 4:7711051-7711073 CTTAGGGAGCACAGGGAGGCAGG + Intronic
969933580 4:10658584-10658606 CTTTGGGGAGATAGGGAGGCTGG - Intronic
970195026 4:13544233-13544255 CTCTTTGGGGAGAGGGACGCGGG - Exonic
970429073 4:15972082-15972104 CTTATTGAGCAGAGGGATGCTGG + Intronic
970887146 4:20999566-20999588 GTTTGGGGGAAGAGGGTGGCTGG + Intronic
971037155 4:22706156-22706178 ATTTTGCGGCAGAGGTGGGCAGG + Intergenic
972052179 4:34750927-34750949 CTTTGGGGGCCGAGGCAGGCGGG + Intergenic
972281213 4:37603608-37603630 CTTTTGGGGTGGAGGAAGCCTGG + Intronic
972566703 4:40276084-40276106 CTTTGGGGGCAGAGGAGGGTGGG - Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
973155983 4:46953257-46953279 CTTTAGGGGGTGAGGGATGCTGG - Intronic
973995338 4:56452920-56452942 ATTTTGGGGGAGTGGGAGGTTGG + Intronic
975071392 4:70144180-70144202 CTTGAGGGGAAGAGTGAGGCGGG - Intronic
975281515 4:72568221-72568243 TTTTTCGGGCAGCCGGAGGCGGG - Intronic
975890052 4:79016943-79016965 CTCCAGGGGCAGAGAGAGGCTGG - Intergenic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
978287400 4:107095081-107095103 CTTTTGGGCCAGGAGAAGGCAGG - Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
979004958 4:115282438-115282460 CTCGTGGGGTGGAGGGAGGCGGG + Intergenic
980281991 4:130734712-130734734 GTTGTGGGGCAGGGGGAGGGGGG + Intergenic
980294862 4:130899826-130899848 CTTTTGGAGCAGAGCAAAGCAGG - Intergenic
980416439 4:132495452-132495474 CTTTTGAGCCAGGGGGAGCCAGG - Intergenic
980653175 4:135747936-135747958 GTTGTGGGGCAGGGGGAGGGGGG - Intergenic
981665089 4:147215280-147215302 CTTTGGGGGCATAGGCATGCAGG - Intergenic
982265658 4:153536209-153536231 CTGATGGGGCAGAGGGAGTGAGG + Intronic
982320552 4:154072697-154072719 CTTTTGGGGCAGGGGGAGACAGG + Intergenic
984004296 4:174290094-174290116 TTTTGGGGGCTGAGGCAGGCGGG - Intronic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
985309502 4:188581704-188581726 TGCGTGGGGCAGAGGGAGGCAGG + Intergenic
985776695 5:1848069-1848091 CTTTGGTGGTAGAAGGAGGCTGG + Intergenic
985818492 5:2144391-2144413 CTGTTGAGGGAGAGGGAGGTGGG - Intergenic
988641187 5:33041955-33041977 GGTGTGGGGCAGAAGGAGGCAGG + Intergenic
989412847 5:41140312-41140334 GTTTGGGGGAAGAGGGAGGATGG + Intergenic
989804607 5:45587545-45587567 CTTGTGGGGTAGGGGGAGGGGGG + Intronic
990356389 5:54970805-54970827 TTTTTGAGTCAGAGGGAGGCAGG - Intergenic
990406100 5:55492592-55492614 ATTTAGTGGTAGAGGGAGGCAGG + Intronic
991445553 5:66696195-66696217 CTGTTGGGGCGGAGGGTGGGAGG + Intronic
992081098 5:73234628-73234650 CTTTCGGGGGTGGGGGAGGCAGG - Intergenic
992732278 5:79683810-79683832 CTTGGGAGGCTGAGGGAGGCAGG + Intronic
992787396 5:80183281-80183303 CGTTTGGGGTGGAGGGAGGGTGG + Intronic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
993847060 5:92957144-92957166 CTTGTGGGGTGGAGGGTGGCAGG + Intergenic
995209418 5:109520461-109520483 CTTTTGGGGCTGAGGCAGAAGGG - Intergenic
997715707 5:136041082-136041104 TTGTTGGGGCAGTTGGAGGCAGG + Intronic
997937734 5:138129117-138129139 TTTGGGGGGCAGAGGGTGGCAGG - Intronic
998139216 5:139690467-139690489 ATTCTGAGGCAGAGGGAGGCAGG - Intergenic
999319704 5:150606276-150606298 TTGTTGGGGCAGAGGGGAGCAGG - Intronic
999478329 5:151922242-151922264 ATTTGGGGGTAGATGGAGGCTGG - Intronic
999858222 5:155618103-155618125 CTTTTGGGGCAGGGGATGGGAGG + Intergenic
1000195616 5:158954705-158954727 CATCTTGGGCAGAGTGAGGCTGG - Intronic
1000507037 5:162133899-162133921 TTGTTGAGGCAGAGGCAGGCTGG + Intronic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002345774 5:178546762-178546784 CTTGTGGGGCTGATGGAAGCGGG - Intronic
1004222338 6:13757497-13757519 ATTTTGGGAGAGAGAGAGGCAGG + Intergenic
1004365973 6:15013048-15013070 TTTTTGGAGCAAAGGGAGACCGG - Intergenic
1004442552 6:15667663-15667685 GTTGTGGGGTGGAGGGAGGCGGG + Intergenic
1005826069 6:29632591-29632613 GGTTGGGGGCCGAGGGAGGCAGG - Intronic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006378967 6:33686982-33687004 GTGGAGGGGCAGAGGGAGGCAGG - Intronic
1006404709 6:33838196-33838218 GTTTGCGGGCAGAGGGAGGAGGG + Intergenic
1006522666 6:34581112-34581134 CTTCTGGGTGAGGGGGAGGCGGG - Intergenic
1007072865 6:39049298-39049320 ACTGTGGGGCAGAGGGAGTCCGG - Intronic
1007234062 6:40378064-40378086 CTGTTGGGGCTAAGGGAGGTGGG - Intergenic
1007757140 6:44107220-44107242 CTGATGGGTCAGAGGGAGGCAGG - Intergenic
1008385747 6:50888093-50888115 GTTGTGGGGTGGAGGGAGGCGGG - Intergenic
1009874338 6:69486187-69486209 GTTTTGGGGTAGGGGGAGGGGGG + Intergenic
1010351774 6:74883429-74883451 GTTGTGGGGCAGGGGGAGGGGGG - Intergenic
1010354081 6:74909753-74909775 GTTGTGGGGCAGGGGGAGGGGGG + Intergenic
1010633781 6:78231704-78231726 GTTGTGGGGCAGGGGGAGGGGGG - Intergenic
1011496038 6:87937341-87937363 GTGTTGGGGAAGAGGGATGCTGG + Intergenic
1011709126 6:90033203-90033225 GTTTTGGGGAGGAGGGAGGGGGG + Intronic
1011714121 6:90086516-90086538 CTTGTGGGGCAGAGGGCGACAGG - Intronic
1012285874 6:97387662-97387684 GTTGTGGGGTAGGGGGAGGCGGG - Intergenic
1014038538 6:116797028-116797050 GTTGTGGGGTAGGGGGAGGCGGG - Intronic
1014097328 6:117474565-117474587 GTTGTGGGGCAGGGGGAGGGAGG + Intronic
1014349024 6:120316082-120316104 GTTGTGGGGTAGGGGGAGGCGGG - Intergenic
1015243195 6:131049170-131049192 GTTTTCGGGCAGAGGGAGGTGGG + Intronic
1015558350 6:134486305-134486327 CTGTTGGGGCAGGGTGGGGCTGG - Intergenic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017760237 6:157562868-157562890 CTTGGGGGGCGGTGGGAGGCGGG - Intronic
1018150106 6:160930063-160930085 CTTTTGTGGCAGATGGAGCAGGG + Intergenic
1019127237 6:169848932-169848954 CTTCTTGGGCAGAATGAGGCTGG + Intergenic
1019512024 7:1422370-1422392 GGGTTGGGGCAGAGTGAGGCTGG - Intergenic
1019609384 7:1929244-1929266 TCTTTGGGGAGGAGGGAGGCAGG - Intronic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1020983177 7:15097116-15097138 CTATTGGGGCGGGGGGGGGCGGG - Intergenic
1021038501 7:15831319-15831341 CCTTTGGTGCATAGGAAGGCAGG - Intergenic
1021915349 7:25426047-25426069 TTCTTGGGGCAGAAGGATGCAGG + Intergenic
1022041752 7:26588151-26588173 CTGGTGGGGAGGAGGGAGGCTGG + Intergenic
1022707985 7:32824007-32824029 GTTGTGGGGTGGAGGGAGGCGGG - Intergenic
1023742756 7:43295227-43295249 CTTTTGTGAGAGAGGGAGGGAGG + Intronic
1025487930 7:61075092-61075114 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1025512033 7:61581975-61581997 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1025556583 7:62317006-62317028 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1025566057 7:62435379-62435401 CTGTTAGGGCATAGGGAGGTTGG + Intergenic
1025818630 7:64943103-64943125 CTTCTGGTGGAGAGGGAGGCTGG - Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1026794868 7:73359704-73359726 TTTTTGGGGTGGCGGGAGGCAGG - Intergenic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1027176468 7:75906962-75906984 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1028101918 7:86831185-86831207 CCTTTGGGGCTGAGGAAGGGTGG + Intronic
1028840878 7:95429178-95429200 CTTGTGGGGTAGGGGGAGGGGGG - Intronic
1028947644 7:96599039-96599061 CTAGAGGGGCAGAGGGAGGGAGG + Intronic
1029249646 7:99226640-99226662 CTTGTGGGGCTGTGTGAGGCGGG + Intergenic
1029708921 7:102289126-102289148 CTGTTTGGGCAGAGCAAGGCAGG + Intronic
1030498895 7:110334362-110334384 CTGTTGGGGCAGAGGGTTGGTGG - Intergenic
1030932612 7:115543578-115543600 CTTCTGGGGGAGAGGTAGGGAGG - Intergenic
1031117910 7:117688043-117688065 TTGCTGGGGCAGAGGGAGGGTGG + Intronic
1032155191 7:129462257-129462279 TGTGTGGGACAGAGGGAGGCGGG + Intronic
1032607364 7:133370133-133370155 CTTTTGGGGGGGAGGGTGGGCGG - Intronic
1033024035 7:137755402-137755424 GTTTAAGGGCAGAGGGAGGAGGG + Intronic
1033050177 7:137997030-137997052 CTTTAGGGGGAGAGGTTGGCAGG - Intronic
1033331300 7:140418923-140418945 CCTTTGGGGCAGAAGGAGTGTGG - Intronic
1033463945 7:141573726-141573748 CTTGTGAGGCAGAGGGACGTGGG + Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1033974964 7:147089850-147089872 CCTTTGGTGCAGAGTGAGGACGG - Intronic
1034165260 7:149020583-149020605 CTTTGAGGGAAGAGGAAGGCAGG + Intronic
1035905772 8:3508353-3508375 GTTATGGGGCAGGGGGAGGGGGG + Intronic
1036729206 8:11247115-11247137 TGTTTGGGGCAGGGGGAGTCTGG - Intergenic
1037315535 8:17595874-17595896 CTTTTGAGGGAGGGGCAGGCAGG + Intronic
1037628524 8:20629964-20629986 CTTTTGGGTAAGTGGGTGGCTGG + Intergenic
1037925676 8:22842429-22842451 CTTGTGGGGCTGAAGGAGGTAGG + Intronic
1038516478 8:28191795-28191817 TTCTGGTGGCAGAGGGAGGCGGG - Intergenic
1038667010 8:29546722-29546744 CTTTTGGGGAAGACAGAGGTTGG - Intergenic
1041953810 8:63535162-63535184 CTTTTGGGGGGGTGGGAGGCTGG + Intergenic
1042599905 8:70489031-70489053 GTTGTGGGGTAGAGGGAGGGCGG - Intergenic
1045413600 8:101944553-101944575 CTTCTGGGGCACTGGAAGGCAGG - Intronic
1045789043 8:105959286-105959308 GTTGTGGGGCAGGGGGAGGGGGG + Intergenic
1045789720 8:105968335-105968357 GTTGTGGGGCAGGGGGAGGGGGG + Intergenic
1047006891 8:120630121-120630143 CTGAAGGGGCAAAGGGAGGCTGG - Intronic
1048043654 8:130753771-130753793 TTTCTGAAGCAGAGGGAGGCTGG - Intergenic
1048442160 8:134468127-134468149 CTCATGGGGCACTGGGAGGCAGG - Intergenic
1048452475 8:134545732-134545754 CTTTTGGGACAGAGAAAGGGTGG + Intronic
1048610002 8:136011911-136011933 AGTTTGGGGCAGGGGGAGGAGGG - Intergenic
1048826086 8:138428661-138428683 CTTTTGTGGTGGAGGGAGCCTGG - Intronic
1048830395 8:138471165-138471187 GATTTGGGGCAGAGTGTGGCTGG + Intronic
1048830412 8:138471329-138471351 GATTTGGGGCAGAGTGTGGCTGG + Intronic
1048847879 8:138616999-138617021 CTCTTGGGGCAGAAGTGGGCAGG + Intronic
1049730296 8:144173939-144173961 CTCTTGGGGGAGAGGGGAGCTGG + Intronic
1049847103 8:144808142-144808164 CTTCTGGTGCAGAGTGAGGTTGG - Exonic
1049930737 9:454178-454200 CTAGTGGGGAAGAGGGAGCCAGG + Intronic
1050670932 9:7996485-7996507 CTTTTGGGGCCGGGTGAGGTAGG - Intergenic
1051017830 9:12502507-12502529 CTTTTGGGGCATAGGTGGGCAGG - Intergenic
1051561588 9:18447458-18447480 CCTGTGGGGAAGAGGGAGGGAGG + Intergenic
1052570538 9:30215671-30215693 GTTGTGGGGTGGAGGGAGGCGGG + Intergenic
1052972362 9:34384936-34384958 GTGGTGGGGCAGAGGGATGCAGG + Intronic
1052973937 9:34398512-34398534 CATGTGTGGCAGAGAGAGGCAGG - Exonic
1053286027 9:36850069-36850091 CTTTGATGGCAGAGAGAGGCGGG + Intronic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053946562 9:43315018-43315040 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1056036724 9:82614262-82614284 CTTGTGGGGCTGTGGTAGGCTGG - Intergenic
1056532197 9:87497824-87497846 CCTTTTGGGCGGAGGGCGGCCGG - Intronic
1056754823 9:89375099-89375121 CTTTGCGGGCAGATGCAGGCAGG - Intronic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057030689 9:91773120-91773142 CTTCTGGAGCAGAGGGCTGCAGG - Intronic
1057122361 9:92587683-92587705 TTGTTGGGGCCAAGGGAGGCAGG + Intronic
1057205515 9:93169822-93169844 GTTTTTGAGCAGAGAGAGGCTGG + Intergenic
1057947950 9:99346115-99346137 GTCTTGGGGCAGAGGGAGCAGGG - Intergenic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058233560 9:102461508-102461530 CTGGTGGGGCAGGGGGTGGCGGG + Intergenic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059529801 9:115025433-115025455 CTTTCAGGGCTCAGGGAGGCTGG + Intronic
1060736387 9:126069012-126069034 CTTTGGGGGCAGCGGTAGGGTGG + Intergenic
1060813059 9:126620676-126620698 CCTTGGGGGCAGACGGAGGGTGG + Intronic
1061002382 9:127909847-127909869 CTGTGGGGGCAGAGGGAGTGTGG - Intronic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061392600 9:130326134-130326156 GGTCTGGGGCAGAGAGAGGCGGG - Intronic
1061909287 9:133714314-133714336 CTTGAGGGGCAGAAGGTGGCAGG + Intronic
1061941635 9:133887129-133887151 CCTTTGGGGCAGGGTGAGGTAGG + Intronic
1062146726 9:134993568-134993590 CTTTGGGAGCAGAGGGACTCTGG + Intergenic
1062170301 9:135131168-135131190 CCTCTGGGGGACAGGGAGGCCGG + Intergenic
1062324945 9:136008314-136008336 CCCTTGGGGAAGAGGAAGGCAGG + Exonic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1203463901 Un_GL000220v1:68265-68287 CTTCTGGGGGGGAGGGAGGTGGG - Intergenic
1203589692 Un_KI270747v1:43576-43598 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1186110152 X:6246957-6246979 GTTTTGGGGTGGGGGGAGGCGGG - Intergenic
1186168230 X:6849640-6849662 TTTTTGGGGCACATGGGGGCAGG - Intergenic
1187298780 X:18027923-18027945 TGTTTGGGGCAGTGGGAGGAGGG + Intergenic
1187795538 X:22999962-22999984 CTTTTGGTGCAGAAGGTGACGGG + Exonic
1189267900 X:39730571-39730593 CTTTTGGGGCCGAAGGTGGGGGG + Intergenic
1189279974 X:39814125-39814147 CTTTTTGTGCACAGGGACGCCGG + Intergenic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1189988096 X:46571583-46571605 CTTTTGGAGCGGAGGGCGGGGGG + Intergenic
1190518628 X:51252565-51252587 GTTGTGGGGTGGAGGGAGGCGGG - Intergenic
1191585833 X:62825581-62825603 GTTTTGGGGTAGGGGGAGGGGGG + Intergenic
1193673210 X:84415450-84415472 CTCTTGGAGCACAAGGAGGCTGG - Intronic
1194891521 X:99384919-99384941 ACTTTGGCACAGAGGGAGGCTGG - Intergenic
1195049055 X:101080215-101080237 CTTTTAGGGCTGAGGCAGGGAGG + Intronic
1195255899 X:103090671-103090693 CTTTTGGGGCAGGGGGAGGCGGG + Intronic
1195706033 X:107738628-107738650 CATATGGGGCATAGGGAGTCTGG + Intronic
1197277132 X:124492804-124492826 CTGGTGGGGCAGTGGGAGGCAGG + Intronic
1199013647 X:142786255-142786277 GTTGTGGGGCAGGGGGAGGGGGG - Intergenic
1199404220 X:147437191-147437213 CTTGTGGGGAAGAGGGAGAAAGG - Intergenic
1200066509 X:153506665-153506687 CTGTTGGGGGTGAGGCAGGCAGG - Intronic
1201013764 Y:9576612-9576634 GTTGTGGGGCGGAGGGAGGGTGG + Intergenic