ID: 961871594

View in Genome Browser
Species Human (GRCh38)
Location 3:129992609-129992631
Sequence TGCCATGAGTGCTCACATAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961871590_961871594 11 Left 961871590 3:129992575-129992597 CCCCCAGTGGGTCTGCTGGCTGT No data
Right 961871594 3:129992609-129992631 TGCCATGAGTGCTCACATAGCGG No data
961871591_961871594 10 Left 961871591 3:129992576-129992598 CCCCAGTGGGTCTGCTGGCTGTG No data
Right 961871594 3:129992609-129992631 TGCCATGAGTGCTCACATAGCGG No data
961871592_961871594 9 Left 961871592 3:129992577-129992599 CCCAGTGGGTCTGCTGGCTGTGA No data
Right 961871594 3:129992609-129992631 TGCCATGAGTGCTCACATAGCGG No data
961871593_961871594 8 Left 961871593 3:129992578-129992600 CCAGTGGGTCTGCTGGCTGTGAT No data
Right 961871594 3:129992609-129992631 TGCCATGAGTGCTCACATAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961871594 Original CRISPR TGCCATGAGTGCTCACATAG CGG Intergenic
No off target data available for this crispr