ID: 961872605

View in Genome Browser
Species Human (GRCh38)
Location 3:129999747-129999769
Sequence GCTGTGGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961872597_961872605 10 Left 961872597 3:129999714-129999736 CCTAGGAGAGACTTTTCTCTCCC No data
Right 961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG No data
961872602_961872605 -10 Left 961872602 3:129999734-129999756 CCCTCCAGGAGGAGCTGTGGGTC No data
Right 961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG No data
961872596_961872605 17 Left 961872596 3:129999707-129999729 CCAAATACCTAGGAGAGACTTTT No data
Right 961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961872605 Original CRISPR GCTGTGGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr