ID: 961874547

View in Genome Browser
Species Human (GRCh38)
Location 3:130011702-130011724
Sequence GAAGCTTATTCCTTCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961874547_961874551 0 Left 961874547 3:130011702-130011724 CCCCACCAGAAGGAATAAGCTTC No data
Right 961874551 3:130011725-130011747 GAATACATCTGAACATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961874547 Original CRISPR GAAGCTTATTCCTTCTGGTG GGG (reversed) Intergenic
No off target data available for this crispr