ID: 961876382

View in Genome Browser
Species Human (GRCh38)
Location 3:130026746-130026768
Sequence AAGGGCCTACTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961876382_961876389 9 Left 961876382 3:130026746-130026768 CCCCCAGAGTTCAGTAGGCCCTT No data
Right 961876389 3:130026778-130026800 TCATGCTCCATGCACTTGAAGGG No data
961876382_961876388 8 Left 961876382 3:130026746-130026768 CCCCCAGAGTTCAGTAGGCCCTT No data
Right 961876388 3:130026777-130026799 ATCATGCTCCATGCACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961876382 Original CRISPR AAGGGCCTACTGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr