ID: 961876893

View in Genome Browser
Species Human (GRCh38)
Location 3:130029931-130029953
Sequence GCTCGTTTACGACCCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961876893_961876900 -6 Left 961876893 3:130029931-130029953 CCCGTTTTGGGTCGTAAACGAGC No data
Right 961876900 3:130029948-130029970 ACGAGCTGCCGAGGGAGGGGTGG No data
961876893_961876901 -1 Left 961876893 3:130029931-130029953 CCCGTTTTGGGTCGTAAACGAGC No data
Right 961876901 3:130029953-130029975 CTGCCGAGGGAGGGGTGGAATGG No data
961876893_961876899 -9 Left 961876893 3:130029931-130029953 CCCGTTTTGGGTCGTAAACGAGC No data
Right 961876899 3:130029945-130029967 TAAACGAGCTGCCGAGGGAGGGG No data
961876893_961876898 -10 Left 961876893 3:130029931-130029953 CCCGTTTTGGGTCGTAAACGAGC No data
Right 961876898 3:130029944-130029966 GTAAACGAGCTGCCGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961876893 Original CRISPR GCTCGTTTACGACCCAAAAC GGG (reversed) Intergenic
No off target data available for this crispr