ID: 961878771

View in Genome Browser
Species Human (GRCh38)
Location 3:130045290-130045312
Sequence TCGCATCCCCGGCCCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961878771_961878775 17 Left 961878771 3:130045290-130045312 CCACAGTGGGGCCGGGGATGCGA No data
Right 961878775 3:130045330-130045352 ACCTCTCTCCAGCAGCATTGAGG No data
961878771_961878773 -8 Left 961878771 3:130045290-130045312 CCACAGTGGGGCCGGGGATGCGA No data
Right 961878773 3:130045305-130045327 GGATGCGACTGAGAGTTTTCTGG No data
961878771_961878777 21 Left 961878771 3:130045290-130045312 CCACAGTGGGGCCGGGGATGCGA No data
Right 961878777 3:130045334-130045356 CTCTCCAGCAGCATTGAGGATGG No data
961878771_961878774 -7 Left 961878771 3:130045290-130045312 CCACAGTGGGGCCGGGGATGCGA No data
Right 961878774 3:130045306-130045328 GATGCGACTGAGAGTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961878771 Original CRISPR TCGCATCCCCGGCCCCACTG TGG (reversed) Intergenic