ID: 961883146

View in Genome Browser
Species Human (GRCh38)
Location 3:130077303-130077325
Sequence AAACACTGATTGTCTAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961883142_961883146 22 Left 961883142 3:130077258-130077280 CCTCTTCAGAGTCATAATTTGGC No data
Right 961883146 3:130077303-130077325 AAACACTGATTGTCTAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961883146 Original CRISPR AAACACTGATTGTCTAAAAC GGG Intergenic
No off target data available for this crispr