ID: 961885003

View in Genome Browser
Species Human (GRCh38)
Location 3:130091291-130091313
Sequence TTTCTTTAAAGAGGCACCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 3, 1: 4, 2: 4, 3: 15, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961884996_961885003 28 Left 961884996 3:130091240-130091262 CCTGCCATGATTTCATTGCAGGG 0: 9
1: 1
2: 0
3: 14
4: 118
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203
961884994_961885003 29 Left 961884994 3:130091239-130091261 CCCTGCCATGATTTCATTGCAGG 0: 6
1: 1
2: 3
3: 7
4: 151
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203
961884998_961885003 24 Left 961884998 3:130091244-130091266 CCATGATTTCATTGCAGGGCTGT 0: 9
1: 0
2: 0
3: 10
4: 161
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203
961885000_961885003 -1 Left 961885000 3:130091269-130091291 CCGTCTACGACAAGCCGGCATCT 0: 1
1: 9
2: 1
3: 1
4: 37
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961885003 Original CRISPR TTTCTTTAAAGAGGCACCTC TGG Exonic
903106922 1:21088895-21088917 TTTCTGTAAATATTCACCTCTGG - Intronic
904111109 1:28127063-28127085 TTTCTTTGAAGAGGGAACTTAGG - Intergenic
904498672 1:30901905-30901927 CTTCTTTAAAATGGGACCTCAGG - Intronic
908564524 1:65340924-65340946 TTTTTTAAAACAGGCACCCCAGG + Intronic
908883114 1:68755747-68755769 TTTCTTTAAAGTGGAAGCTAAGG - Intergenic
909892761 1:81028371-81028393 TTTTCTTAAAGCAGCACCTCTGG - Intergenic
912195143 1:107389050-107389072 TTTCCTTAATGAGGCCCCTTGGG - Intronic
914814110 1:151050584-151050606 TTTCTTTACAGAGGTACCTGAGG + Exonic
917212927 1:172648257-172648279 TTTCTTTCAGGAGGCTCATCAGG - Intergenic
917518838 1:175731625-175731647 TTTCATTAAGGAGGCACGGCGGG + Intronic
917952418 1:180053600-180053622 ATTCTTTAAAAAGGCACATGAGG - Intronic
918972163 1:191433418-191433440 TCTCTTGAAAGTGCCACCTCCGG + Intergenic
920770352 1:208878899-208878921 TTCCTTTAAAGAGGCAAAACTGG + Intergenic
922182502 1:223246395-223246417 CTTCTCTAAAGAGTCACCTGAGG - Intronic
1063112918 10:3052497-3052519 TTTTTTTACAGAAGCAGCTCTGG + Intergenic
1063551116 10:7034392-7034414 TTTCTTTAGAGAGGCACAGTAGG - Intergenic
1065167389 10:22994146-22994168 TTTCCTCAAGGAGGCACTTCTGG - Intronic
1066212625 10:33254877-33254899 TTTGTTTAAAGAAGCACATTAGG + Intronic
1066212977 10:33257959-33257981 TTTGTTTAAAGAAGCACATTAGG + Intronic
1066706002 10:38178737-38178759 TTACTATAAAGAGGTACCTAAGG + Intergenic
1066984300 10:42450827-42450849 TTACTATAAAGAGGTACCTAAGG - Intergenic
1068414248 10:56697155-56697177 TTTCTTCAGAGAGACACCTCAGG - Intergenic
1069202000 10:65631010-65631032 GTTCTTTAAAGAGGAACTCCAGG + Intergenic
1069230137 10:65998315-65998337 TTTCTTTAAAGATGTACAACTGG + Intronic
1069819913 10:71221075-71221097 TGTGTTTACAGAGGCCCCTCTGG + Intronic
1070986082 10:80691010-80691032 TTTCTTTAGAAAGACATCTCAGG + Intergenic
1071574238 10:86714361-86714383 ATTCTTTACAGAGGCAGCTTGGG + Intronic
1071709653 10:88037698-88037720 TCTCTGTAAAAAGGCCCCTCAGG + Intergenic
1071721603 10:88152210-88152232 TTTCTTTGAAGAACCACCCCAGG - Intergenic
1072257854 10:93638028-93638050 TTTCTAGAAAGTGGCTCCTCTGG + Intronic
1076050611 10:127330261-127330283 TTTCTTTAAAGAACCAACACAGG + Intronic
1078050336 11:7960321-7960343 CTTCTTCAAATAGGAACCTCTGG + Exonic
1079952126 11:26819001-26819023 TCTCTTGAAAGCGCCACCTCTGG - Intergenic
1080103028 11:28481696-28481718 TTTCTTCAAAGCCGCAGCTCAGG + Intergenic
1080360040 11:31502490-31502512 TTTCTTTAGAGAGGAGCTTCAGG + Intronic
1081512282 11:43787823-43787845 TTTCTTTAAAAAGGGAACTTTGG - Intronic
1084235441 11:67785303-67785325 TTTCTTTAAAGAGACACCTCTGG + Intergenic
1085009558 11:73128827-73128849 ATTCTTTAAAGAGTAACCTGTGG - Intronic
1088137041 11:106568239-106568261 TTTTTGTACAGTGGCACCTCAGG + Intergenic
1091914854 12:4263855-4263877 TTTGTTTAAAGAGGCTCACCAGG + Intergenic
1094163070 12:27412254-27412276 TTTATATAAGGAGGCACCTTAGG + Intronic
1094802189 12:34049157-34049179 TTTCTGGAAAGTGCCACCTCTGG + Intergenic
1095225835 12:39675467-39675489 TCTCTTGAAAGTGCCACCTCTGG + Intronic
1096236299 12:49929571-49929593 TCTCTTTCTAGAGGCAGCTCAGG - Intergenic
1097468961 12:59964912-59964934 TTTCTAGAAAGAGGCACAGCTGG - Intergenic
1101847126 12:108371586-108371608 TGTATTTAAAGAGCCACCTGTGG + Intergenic
1104932838 12:132348871-132348893 TTTCTCTAAGGAGGTACCCCTGG + Intergenic
1105811060 13:23995930-23995952 TTTCCTTAAACAGGAAGCTCAGG - Intronic
1106593492 13:31117911-31117933 TTTCTTGGCAGAGGCATCTCAGG + Intergenic
1106827207 13:33536718-33536740 TTTCTTTAAAGAGGAAAACCAGG - Intergenic
1107182938 13:37483485-37483507 TTTTTTTAAAGAGGCATTTAAGG + Intergenic
1107262133 13:38505682-38505704 CTTCTAGAAAGAGGCACCTCAGG + Intergenic
1107735818 13:43397540-43397562 TTTCTTTAAAGATGCCCTTGTGG + Intronic
1109339066 13:61030977-61030999 TTTGTTCAAAGAGAAACCTCTGG - Intergenic
1109502112 13:63251397-63251419 TTTCTCTGAAGAGGTAGCTCGGG + Intergenic
1110334384 13:74310025-74310047 TTTCTCTAAAGAGGAAACTGAGG + Intergenic
1110963935 13:81666851-81666873 TTTCTTTAAAGAGGCTATTCAGG - Intergenic
1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG + Intronic
1113193772 13:107781212-107781234 TTTTTTTGCAGAGGCATCTCTGG - Intronic
1115074659 14:29373090-29373112 TTTCTGTAAAGAAGGACCACAGG + Intergenic
1116523118 14:45873189-45873211 TTTCTTTAAAAAGCCACTTGTGG + Intergenic
1117816317 14:59601822-59601844 TATTTTTAAACAGGCTCCTCAGG + Intronic
1118398764 14:65360431-65360453 TTGATTTAAAAAGGCATCTCTGG - Intergenic
1119011115 14:70990156-70990178 TGTCTTTAACGAGGCACCTCTGG + Intronic
1119136668 14:72227782-72227804 TGTCTGTATAGAGGGACCTCTGG + Intronic
1119276202 14:73358554-73358576 CATCTTTAAAGAGTCAGCTCAGG + Intronic
1119746248 14:77046285-77046307 TTGCTTTCAAGAGTCACATCTGG - Intergenic
1121522082 14:94593127-94593149 TGTCTTTATGGAGGCAGCTCTGG + Intronic
1124621023 15:31273970-31273992 TTTCTGTCAAGAGGCTCCCCTGG - Intergenic
1125792057 15:42374420-42374442 AATCTTCAAAGAGGCACTTCTGG - Intronic
1127043409 15:55001676-55001698 CTTCTATACAGAGTCACCTCTGG - Intergenic
1127059769 15:55170250-55170272 TCTTTTTAAAGAGGCATTTCTGG - Intergenic
1128117380 15:65118537-65118559 TCTGATTCAAGAGGCACCTCTGG + Exonic
1128375827 15:67075128-67075150 TTTCCTTAAAAAATCACCTCTGG + Intronic
1128957182 15:71960543-71960565 TTTCTATAAAGAAACACCTATGG - Intronic
1129899817 15:79138002-79138024 TTTCTTTAGAGAGAGCCCTCCGG - Intergenic
1132224379 15:100128986-100129008 TCCCTTCAAAGAGGCACCTATGG + Intronic
1133347007 16:5077937-5077959 TTTCTTTAAAGAGACACCTCTGG + Exonic
1135403636 16:22183015-22183037 TTTTTTTAAAAAAACACCTCTGG + Intronic
1137648819 16:50100600-50100622 TTTTTTTAAAAAAGTACCTCTGG - Intronic
1138902474 16:61290070-61290092 ATTATGTAAAGAGGCACCTCGGG - Intergenic
1139176345 16:64693183-64693205 TTTCTTTATCAAGGCTCCTCAGG + Intergenic
1147035982 17:37681298-37681320 TTTCTTTAAAGTGGTACCTTAGG - Intergenic
1148563500 17:48619786-48619808 TGTCTTTAAAGAAGCAGCCCTGG + Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1152826365 17:82467811-82467833 TGACTTTTAAGAGGCATCTCTGG + Intronic
1155329299 18:24698619-24698641 GGTCTTTAAAGAGGCAACTAAGG + Intergenic
1155716321 18:28948255-28948277 TTGCTTTGGATAGGCACCTCTGG - Intergenic
1156660534 18:39341090-39341112 TCTTTTTCAAGAGGCACCACAGG - Intergenic
1157200324 18:45654023-45654045 TTCCTTTAAAGAGGCAGAGCTGG - Intronic
1157902694 18:51535284-51535306 TTTCTTCCAAAAGGCAGCTCGGG + Intergenic
1158638899 18:59185460-59185482 TTTCTTTAAAGATGAAGCTCTGG + Intergenic
1158850437 18:61491209-61491231 TTTCATTAAATTTGCACCTCAGG - Intronic
1158932747 18:62336982-62337004 TTTCCTTTAAGAAGCACATCTGG + Intronic
1158958000 18:62560176-62560198 TTTCTTAAAAGAGGCAAATATGG + Intronic
1159976221 18:74715301-74715323 TTTCTTTAAATACGCACATTTGG - Intronic
1163302170 19:16454826-16454848 TTTTTTTTAAGAGACAGCTCTGG + Intronic
1164409533 19:27989227-27989249 TTTGTTTAAAGAGGGTCCTAAGG - Intergenic
1164742910 19:30589964-30589986 TATCTTTAAAGATGATCCTCTGG - Intronic
1166880785 19:45928796-45928818 GTTCTCTAAAGAGGCCTCTCCGG - Intergenic
925409565 2:3632112-3632134 TGTCTGTCAAGTGGCACCTCAGG - Intronic
935607218 2:104983181-104983203 TTGATTTAAAGAGGTACTTCAGG + Intergenic
935824545 2:106931645-106931667 TTTCTTAAAAGCAGCACCTTGGG + Intergenic
936142282 2:109950677-109950699 TTTCTTTATAGAGGAACATAAGG + Intergenic
936178972 2:110248636-110248658 TTTCTTTATAGAGGAACATAAGG + Intergenic
936202406 2:110420796-110420818 TTTCTTTATAGAGGAACATAAGG - Intronic
937077734 2:119119062-119119084 TTTTTTAAATGAAGCACCTCTGG + Intergenic
939358918 2:141143329-141143351 TGACTTTAAAGAGGCCTCTCTGG + Intronic
940554243 2:155203081-155203103 TTTCTTTAAAGCAGTCCCTCTGG - Intergenic
941815241 2:169789652-169789674 TTTTTTTTAAGAGACACATCTGG + Intergenic
944209200 2:197188845-197188867 TTTTTTTTAATAGGCATCTCCGG - Intronic
946031857 2:216711685-216711707 TTTTTTTTAATAGGCACTTCTGG + Intergenic
946356493 2:219188951-219188973 TATCTTTTAAGATGCACTTCAGG + Intergenic
946619845 2:221549063-221549085 TTTCTTAAAAGGAGCACCACTGG - Intronic
947085206 2:226443528-226443550 TTTCGTTAAAGAGACACCATTGG - Intergenic
1172660689 20:36566331-36566353 TTTTTTTAAATAGGCACATATGG - Intergenic
1173631072 20:44516001-44516023 TTTTTTTAAAGAGTAACCTAGGG + Intronic
1174083193 20:47985273-47985295 TTTCTTCAAGGAGGGGCCTCAGG - Intergenic
1175478526 20:59294540-59294562 TTTTTTTAAACAGGCAAATCAGG + Intergenic
1177375022 21:20258717-20258739 TTTCTTTAAACAGACACTCCAGG - Intergenic
1179775331 21:43658513-43658535 TTTGTGTCAACAGGCACCTCGGG + Intronic
1179812945 21:43884067-43884089 TCTCTTTAAAGAGGTGCCTCTGG + Intronic
1180012616 21:45060866-45060888 TTTCATTAAAGAGCAAACTCTGG - Intergenic
1183423962 22:37727696-37727718 TTTCTTAAAATAGGTAGCTCTGG - Intronic
1184482832 22:44758148-44758170 TTTCTGTGAAGAGGCATCTGAGG + Intronic
1185114999 22:48928681-48928703 TTTTTGTAAAGAAGCATCTCTGG + Intergenic
949590231 3:5486538-5486560 AATGTTTAAAGAGGTACCTCAGG - Intergenic
949987258 3:9551224-9551246 TTTTTTAAAATAAGCACCTCAGG - Intronic
950281585 3:11712296-11712318 TTTCTTTAAGGAGGAAACTAGGG - Intronic
952255503 3:31691703-31691725 TTTCTTTAAAGAGACAACTCAGG - Intronic
957051411 3:75415100-75415122 TTTCTTTAAAGAGACACCTCTGG + Intergenic
957303325 3:78421773-78421795 TTACTTTAAATAGCCACCTGTGG - Intergenic
957391918 3:79585786-79585808 TTACTTTTAAGAAGCATCTCAGG + Intronic
960512814 3:118571453-118571475 TCTCTGGAAAGTGGCACCTCCGG - Intergenic
961155856 3:124678947-124678969 TTTCTTTAAATTGGAACCTCTGG + Intronic
961303069 3:125934494-125934516 TTTCTTTAAAGAGACACCTCTGG - Intronic
961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG + Exonic
962154990 3:132936788-132936810 ATTCTTTAAAGAGATACCTTAGG - Intergenic
962593970 3:136921021-136921043 TGTCTTTAAAGAGGTAACTGAGG + Intronic
964375502 3:156044894-156044916 TTTCTTTCAAGAGACACCTCTGG - Intronic
965631544 3:170738515-170738537 GTTTTTTAAAGAGGAACCCCAGG + Intronic
966107471 3:176354151-176354173 TTTCCTTCAAGTGGCAACTCCGG + Intergenic
966161094 3:176969269-176969291 TTTTTCTAATGAGGAACCTCAGG + Intergenic
967479013 3:189953184-189953206 TTGGGTTAATGAGGCACCTCTGG - Intergenic
967729423 3:192893734-192893756 CATCTTTAAAGAGCCACCTCTGG + Intronic
968994193 4:3935479-3935501 TTTCTTTCAAGACACACCTCTGG + Intergenic
969314327 4:6372387-6372409 CTTCTTCAGTGAGGCACCTCTGG - Intronic
969434335 4:7177348-7177370 TCTCTTTAAAGACCCACCTTTGG + Intergenic
969625639 4:8304004-8304026 TTTCTCTTAAGAAGCACATCTGG + Intronic
969762394 4:9198524-9198546 TTTCTTTCAAGAAGCAACACAGG + Intergenic
969819737 4:9710757-9710779 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
971845440 4:31912858-31912880 GTGGTTTAAAGAGGCACTTCTGG + Intergenic
972678744 4:41285464-41285486 TTTCTTAAAAGAAGCAGCTGTGG - Intergenic
975569889 4:75804533-75804555 TTTTTTTAAAAAAGCATCTCAGG - Intronic
976025617 4:80684566-80684588 TTTCTTAAAATAGTCATCTCAGG - Intronic
976505408 4:85840163-85840185 TTTCTTAAAAAAGGCACTTAAGG - Intronic
977523477 4:98115627-98115649 TTTCTATCAATATGCACCTCTGG + Intronic
979409912 4:120364395-120364417 ATTCTTGAAAGAGGCGCCTTAGG - Intergenic
979666518 4:123316922-123316944 TTTTTTAAAAGAGGCCTCTCTGG + Exonic
980077513 4:128309280-128309302 TTGGTTTAAACAGGCACCTTGGG + Intergenic
981173525 4:141653111-141653133 ATTATCTAAAGAGGCACCACTGG + Intronic
984644912 4:182209267-182209289 TTTTTTTAAAGAGGGACAGCTGG - Intronic
986018090 5:3775325-3775347 GTTCTTAAAAGATGCTCCTCTGG + Intergenic
986400826 5:7378137-7378159 ATTCTTTAAAGAAGAACATCAGG + Intergenic
986861197 5:11928312-11928334 TTTCTGTAAAAAGGATCCTCTGG + Intergenic
987444675 5:18003054-18003076 TTTCTTTCAAGAGTCACCCATGG + Intergenic
987483255 5:18487327-18487349 TTTTTTTAAAGAAGCACAGCAGG - Intergenic
987651746 5:20749990-20750012 TTTATTTAAAGTGTCACTTCTGG + Intergenic
988743816 5:34111489-34111511 TTTATTTAAAGTGTCACTTCTGG - Intronic
990384573 5:55247232-55247254 CTTCTTCAAAGAGGCATCCCTGG - Intergenic
992903765 5:81324992-81325014 TTTATTTTAAGAGACACCTGTGG + Intergenic
994988795 5:106972150-106972172 TTTTTTAAAAGAGGAACCACAGG - Intergenic
995344716 5:111098614-111098636 TTTCTTAACAGAAGCATCTCAGG + Intronic
995876063 5:116791132-116791154 TTTCTTTAAAGACTCAGTTCAGG + Intergenic
996146365 5:119981708-119981730 GTTCTCCAAAGAGGAACCTCAGG - Intergenic
996165325 5:120215384-120215406 TTCCTTTACAGAGTCACCTGAGG + Intergenic
1000866378 5:166519545-166519567 TTTCTTTAAAGAGGAAGTTGGGG - Intergenic
1001851594 5:174972161-174972183 TTTCATTAAAGAGGAAGATCTGG + Intergenic
1004993506 6:21165042-21165064 TTCCTTTGAAGAGACACCTGGGG - Intronic
1005592761 6:27345948-27345970 TTTCTTTAAATAGACAACTAAGG - Intergenic
1005850530 6:29817430-29817452 TTTCTGTGAAGATGAACCTCTGG - Intergenic
1006257067 6:32840467-32840489 TTTCCATAGAGAGGCACCTGGGG - Intergenic
1009691000 6:67031711-67031733 TTTCATTAAGGTGGCACGTCTGG - Intergenic
1009706284 6:67256428-67256450 TTTTTTTAAAGAGAGACCTTTGG - Intergenic
1011662223 6:89604477-89604499 TTTCTTTAAAGAGGCTATGCTGG + Intronic
1012377490 6:98580129-98580151 TTTCTGTAAAGAGTCACATTTGG + Intergenic
1018173715 6:161161834-161161856 TTCGTTTAAAGAGGCAGCACAGG + Intronic
1019086422 6:169481750-169481772 GTTCTTTAAGGAGGCACGTCTGG - Intronic
1020318474 7:6923845-6923867 TTTCTTTAAAGGGACACCTCTGG + Intergenic
1021051253 7:15988079-15988101 TTTCTTTGAAGAGGCATTTATGG + Intergenic
1024066344 7:45739772-45739794 TTTCTTTAAAAATGAATCTCAGG - Intergenic
1024858500 7:53810505-53810527 TTTATTTAAATAGGAACCACAGG - Intergenic
1026832237 7:73617317-73617339 TCTCTATAAAGAGGCACCCTCGG - Intronic
1028213596 7:88105086-88105108 TTTCTTCAAAAACGCAACTCTGG - Intronic
1028502929 7:91538962-91538984 TGTGTTTGGAGAGGCACCTCTGG - Intergenic
1030805527 7:113913118-113913140 TCTGTTTAAGGAGGGACCTCTGG - Intronic
1031276756 7:119734049-119734071 TTTCTTTACAGCAGCACTTCAGG - Intergenic
1032747665 7:134804420-134804442 TTTCTTTAAAGAGACTTTTCTGG + Intronic
1034044401 7:147912692-147912714 TTTCATTAATGAGGCTCCTCAGG + Intronic
1034443059 7:151097197-151097219 TTGCTATAAAGAGACACCTGAGG + Intronic
1036272478 8:7320260-7320282 TTTCTTTCAAGAAGCAACACAGG + Intergenic
1036348870 8:7990084-7990106 TTTCTTTCAAGAAGCAACACAGG - Intergenic
1036381945 8:8241348-8241370 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
1036844133 8:12150557-12150579 TTTCTTTCAAGAAGCAACACAGG - Intergenic
1038534078 8:28341473-28341495 CTTCTTTAAAGTGGCTCTTCAGG + Intronic
1038648589 8:29381890-29381912 TTTCTTTCAAGGGGCAGCTGGGG + Intergenic
1039658765 8:39439446-39439468 ATTCTTTAAAGAACCAACTCTGG + Intergenic
1039945937 8:42128841-42128863 TTTTTGTCAACAGGCACCTCCGG + Intergenic
1042986557 8:74590275-74590297 TTTCTTAAAAGAGGAACCATAGG + Intergenic
1046590773 8:116203882-116203904 TTTCTCTAAAGAGGAACTTTGGG + Intergenic
1047051502 8:121117933-121117955 TGTCTATAAAGAGGGACTTCTGG + Intergenic
1047993085 8:130307024-130307046 TTTCCTTAAAGAGATACCTCTGG + Intronic
1051181655 9:14418089-14418111 TTTTTTTAAACAAGCACCCCAGG + Intergenic
1051520812 9:17985796-17985818 TTTCTGTAAAGAGCAACATCTGG + Intergenic
1053414137 9:37935906-37935928 TTTCTTTAATGAGGCAGAGCAGG - Intronic
1054974229 9:71123161-71123183 TTTCTTTCAAAAGGGACTTCAGG + Intronic
1055102395 9:72479439-72479461 GTTCTTAAAAGCGGCACGTCCGG + Intergenic
1055334089 9:75214414-75214436 TGTCTTTAATGAGCCATCTCAGG + Intergenic
1186691676 X:11984431-11984453 ATTCTTCAAAGAGACACTTCAGG + Intergenic
1187983391 X:24783802-24783824 TTTATTTAAATAGCCACCTGTGG - Intronic
1188695164 X:33181173-33181195 ATTGTTTAAAGAGGCAACTGAGG - Intronic
1188910639 X:35842897-35842919 TTTATTTAAAGAGGCAGTTGGGG - Intergenic
1188998060 X:36910378-36910400 TTTCTTTACAAAGGCCCCACAGG + Intergenic
1195000414 X:100637983-100638005 TTGCTTTAAACATACACCTCAGG + Intronic
1195287581 X:103400317-103400339 TTTCTTTAATCAGGCAACTTTGG + Intergenic
1195643153 X:107199729-107199751 TTTCTATAAATAGCAACCTCTGG + Intronic
1196131775 X:112164797-112164819 TCTCTTAAAAGAATCACCTCTGG + Intergenic
1196634507 X:117986655-117986677 TTTCATGCAAGAGGGACCTCTGG - Intronic
1199528810 X:148824143-148824165 TTCCTTTAATGATGCACCTTAGG - Intronic