ID: 961885003

View in Genome Browser
Species Human (GRCh38)
Location 3:130091291-130091313
Sequence TTTCTTTAAAGAGGCACCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 3, 1: 4, 2: 4, 3: 15, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961885000_961885003 -1 Left 961885000 3:130091269-130091291 CCGTCTACGACAAGCCGGCATCT 0: 1
1: 9
2: 1
3: 1
4: 37
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203
961884998_961885003 24 Left 961884998 3:130091244-130091266 CCATGATTTCATTGCAGGGCTGT 0: 9
1: 0
2: 0
3: 10
4: 161
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203
961884996_961885003 28 Left 961884996 3:130091240-130091262 CCTGCCATGATTTCATTGCAGGG 0: 9
1: 1
2: 0
3: 14
4: 118
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203
961884994_961885003 29 Left 961884994 3:130091239-130091261 CCCTGCCATGATTTCATTGCAGG 0: 6
1: 1
2: 3
3: 7
4: 151
Right 961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG 0: 3
1: 4
2: 4
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961885003 Original CRISPR TTTCTTTAAAGAGGCACCTC TGG Exonic