ID: 961887238

View in Genome Browser
Species Human (GRCh38)
Location 3:130104233-130104255
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 3, 1: 5, 2: 4, 3: 7, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961887238_961887244 19 Left 961887238 3:130104233-130104255 CCAGGCCTGTGGTACCGTGGGAG 0: 3
1: 5
2: 4
3: 7
4: 138
Right 961887244 3:130104275-130104297 AGTGTGACCGAGCCTTCCGAGGG 0: 1
1: 3
2: 7
3: 3
4: 29
961887238_961887242 -6 Left 961887238 3:130104233-130104255 CCAGGCCTGTGGTACCGTGGGAG 0: 3
1: 5
2: 4
3: 7
4: 138
Right 961887242 3:130104250-130104272 TGGGAGATGATGGCTGTGCTCGG 0: 1
1: 1
2: 3
3: 72
4: 1339
961887238_961887243 18 Left 961887238 3:130104233-130104255 CCAGGCCTGTGGTACCGTGGGAG 0: 3
1: 5
2: 4
3: 7
4: 138
Right 961887243 3:130104274-130104296 GAGTGTGACCGAGCCTTCCGAGG 0: 1
1: 3
2: 7
3: 9
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961887238 Original CRISPR CTCCCACGGTACCACAGGCC TGG (reversed) Intronic
900506041 1:3030203-3030225 CGCCCCCGGGACCACAGGCGTGG - Intergenic
901051548 1:6428140-6428162 CTCCCAGACTCCCACAGGCCTGG - Intronic
901648059 1:10727206-10727228 CTCCCAGCTTCCCACAGGCCTGG - Intronic
902482772 1:16720221-16720243 CTCCCAGACTCCCACAGGCCTGG + Intergenic
902648258 1:17819173-17819195 CTCCCATGACACCACATGCCAGG + Intronic
904287603 1:29462197-29462219 CTCCCAGGGTCACACAAGCCTGG - Intergenic
904624366 1:31793746-31793768 CTCCCACGGAACCACAGGACAGG - Exonic
905675324 1:39820637-39820659 CTCCCTCGGCACCACGGGACTGG - Intergenic
912757624 1:112337461-112337483 CTCCCACGGAACCTGAGGGCTGG + Intergenic
915142727 1:153777163-153777185 CTCCCACTCTACCACATGTCCGG + Exonic
915644788 1:157261970-157261992 CTTCCAAGGTACCACAAGACAGG + Intergenic
916630060 1:166602790-166602812 CTCCCACCCCACAACAGGCCCGG - Intergenic
918948016 1:191095090-191095112 CTCCCACTGTAACAGAGGTCAGG - Intergenic
923346244 1:233055574-233055596 CACCCACAGGACCACAGACCAGG - Intronic
923666378 1:236002096-236002118 CTCCCACTGTGCCACTGACCAGG - Intronic
1062880500 10:974266-974288 CTCCCACGGAAACCCAGGGCGGG + Intergenic
1063142831 10:3270863-3270885 CTCTCATGGAATCACAGGCCAGG - Intergenic
1069670338 10:70197073-70197095 ATGCCACTGTACCCCAGGCCAGG + Intergenic
1069683846 10:70304228-70304250 CTCCCACCCTAGCACAGGACGGG + Intronic
1069958035 10:72063500-72063522 CTCCCACAGTTCCGCCGGCCTGG + Intronic
1070551660 10:77495259-77495281 CCCCCACGTTACCCCAGCCCAGG + Intronic
1075263247 10:120980418-120980440 TTCGCAGGGGACCACAGGCCAGG - Intergenic
1075510901 10:123072532-123072554 CTACCAGGATAACACAGGCCTGG - Intergenic
1076544401 10:131235084-131235106 GGCCCAGGGTACCACAGGCAGGG + Intronic
1076681177 10:132172205-132172227 TCTCCACGGAACCACAGGCCAGG - Intronic
1077580688 11:3415246-3415268 CTCCCATGGCATCACAGGCCTGG - Intergenic
1080559116 11:33445942-33445964 TTCTCACAGTTCCACAGGCCAGG - Intergenic
1083005628 11:59343172-59343194 ATCCCACCGTACCTCAGGACAGG + Intergenic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084237616 11:67798075-67798097 CTCCCACGGCATCACAGGCCTGG - Intergenic
1084677230 11:70642595-70642617 CTCCCACGGACACAGAGGCCGGG + Intronic
1084834787 11:71794753-71794775 CTCCCACGGCATCACAGTCCTGG + Intronic
1085691516 11:78667981-78668003 GTCCCAGGGTCCCACAGGCAGGG - Intronic
1088054911 11:105563156-105563178 TTTCCAAGTTACCACAGGCCTGG - Intergenic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1097464169 12:59902001-59902023 CTCCCACAGTTCCAGAGGCTGGG + Intergenic
1098358741 12:69634999-69635021 CTCCCACTGAACCAAAGGCAGGG - Intergenic
1098826762 12:75306400-75306422 CCCCCACCCTTCCACAGGCCTGG - Intronic
1104837452 12:131800633-131800655 CCCCCACGGTACCATATACCTGG + Intergenic
1105636446 13:22220219-22220241 CTCCCAAAGGAGCACAGGCCAGG - Intergenic
1108015049 13:46065754-46065776 TTGCCACGGAACCACAGGCCTGG - Intronic
1108338979 13:49477390-49477412 CACACACTGTACCAGAGGCCTGG + Intronic
1112290670 13:98142595-98142617 CTCCCCCGGAGCCACAGGCACGG - Exonic
1112585479 13:100715501-100715523 CAACCAAGGTACCACAGCCCGGG - Intergenic
1114032837 14:18590750-18590772 CCCCCCAGGTACCACAGGACAGG + Intergenic
1114077626 14:19169798-19169820 CCCCCCAGGTACCACAGGACAGG + Intergenic
1114472626 14:22974319-22974341 CTCCCTCTGTACAACAGCCCTGG + Intronic
1114499035 14:23154421-23154443 CACCCACGCCCCCACAGGCCCGG - Intronic
1118990454 14:70792720-70792742 GTCCCAGGGTGCCACAGGTCTGG + Intronic
1119705641 14:76781186-76781208 CTCCCAGGGTGCCTCTGGCCAGG - Exonic
1122425813 14:101604727-101604749 CTCCCACGGTAGCAGAGTCTTGG - Intergenic
1130799707 15:87249916-87249938 CCCCCACGCCACAACAGGCCTGG + Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1133349245 16:5090499-5090521 CTCCTACGGTACCACAGGCCTGG - Exonic
1134624508 16:15714215-15714237 CCCCCAAGGTACCAGAGGCATGG + Intronic
1135058517 16:19251258-19251280 CTACCACTGGACCACAGGCTGGG + Intronic
1136093865 16:27939723-27939745 CTTCCTCGGTCCCCCAGGCCAGG - Intronic
1137676441 16:50305892-50305914 CCCCCACCCTACCCCAGGCCTGG - Intronic
1139850749 16:69950633-69950655 CACCCACGTGACTACAGGCCAGG - Intergenic
1140372791 16:74422003-74422025 CACCCACGTGACTACAGGCCAGG + Intergenic
1142153477 16:88522819-88522841 CTCCCAGGGTGCCACAGGCTCGG - Intronic
1142218988 16:88843761-88843783 ATAACACGTTACCACAGGCCAGG - Intronic
1142983012 17:3682184-3682206 CTCCCCCGATCCCACAGGCCAGG + Intronic
1145798742 17:27670516-27670538 CACCCAGAGGACCACAGGCCTGG - Intergenic
1148791719 17:50176968-50176990 CTCCCACGTGAGGACAGGCCAGG + Intergenic
1149996211 17:61407268-61407290 CTCCCAGGGAGCCTCAGGCCTGG - Intronic
1151903234 17:77031531-77031553 CTGCCAAAGTACCACAGGCTGGG - Intergenic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152458580 17:80429843-80429865 CCCCCACAGGACCACAGCCCAGG + Intronic
1152927431 17:83093748-83093770 CTTCCACGGCACCACACGACGGG - Intronic
1156545479 18:37960086-37960108 TTCCCACAATCCCACAGGCCTGG + Intergenic
1160178877 18:76617580-76617602 CTCCCACGAGACCGCAGGCATGG - Intergenic
1161081071 19:2310424-2310446 CCCCCACGGTTACACAGGCAGGG - Intronic
1165080696 19:33304410-33304432 CTCCCACAACTCCACAGGCCGGG - Intergenic
931692428 2:64846509-64846531 CTCCCAGGGTCCCAGAGGGCAGG - Intergenic
932337585 2:70939739-70939761 GTCCCACGGTACTACAGACTGGG - Exonic
933542171 2:83660338-83660360 CTACAAAGCTACCACAGGCCGGG - Intergenic
935050476 2:99521046-99521068 CTCACACAGTCCCACAGGGCCGG - Intergenic
937578473 2:123454454-123454476 TTCCCACAGTTCCAAAGGCCAGG - Intergenic
938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG + Intergenic
940368609 2:152876446-152876468 CTCCCACAGTTCCACAATCCAGG + Intergenic
947768614 2:232653583-232653605 CTCTAAAGCTACCACAGGCCGGG - Intronic
947907876 2:233778849-233778871 ATCTCACGGTTCCACTGGCCAGG + Intronic
948417806 2:237827608-237827630 CTCACAGGGTTTCACAGGCCAGG + Intronic
949050517 2:241895288-241895310 CTGCCACGGTCCCACAGACTTGG + Intronic
1169213249 20:3779055-3779077 CTTCCACGGGCCCCCAGGCCAGG + Intronic
1170724512 20:18914500-18914522 CTCCCGGGGTGCCACAGTCCAGG - Intergenic
1171988212 20:31675601-31675623 CCCCCACGGAAACATAGGCCTGG + Intronic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1175176780 20:57117352-57117374 CTCCCACAGGACAACAGGGCGGG + Intergenic
1175821984 20:61914972-61914994 CTCCCAGGGAGCCTCAGGCCAGG + Intronic
1175890447 20:62313617-62313639 CTCCCAGGCTGCCCCAGGCCGGG + Intronic
1176615820 21:9027604-9027626 CCCCCCAGGTACCACAGGACAGG - Intergenic
1176709339 21:10136130-10136152 CCCCCCAGGTACCACAGGACAGG + Intergenic
1178579799 21:33828842-33828864 CTCCAGCGGTACCACAGACCAGG - Intronic
1180456953 22:15517807-15517829 CCCCCCAGGTACCACAGGACAGG + Intergenic
1180992077 22:19942639-19942661 CTCCTACGGTCCCTCAGGCTTGG - Intronic
1181123482 22:20688566-20688588 CTCCCAAAGTGCCACAGCCCCGG + Intergenic
1181189686 22:21129074-21129096 CTCCCAAAGTGCCACAGCCCAGG - Intergenic
1181209517 22:21281430-21281452 CTCCCAAAGTGCCACAGCCCAGG + Intergenic
1185139440 22:49092169-49092191 CTGCCACAGTTCCAAAGGCCAGG - Intergenic
1185230594 22:49678323-49678345 CACCCCCGGCAGCACAGGCCAGG + Intergenic
1203217427 22_KI270731v1_random:14005-14027 CTCCCAAAGTGCCACAGCCCAGG - Intergenic
953412321 3:42697424-42697446 CCCCCACGGTGCCACAGTCAGGG - Intronic
955621249 3:60866498-60866520 CTTCTAAGGTACCACATGCCTGG - Intronic
956280548 3:67551578-67551600 CTCCCAGGCTGCCACAGGGCTGG - Intronic
957053570 3:75427842-75427864 CTCCCATGGTACCACAGGCCTGG - Intergenic
961887238 3:130104233-130104255 CTCCCACGGTACCACAGGCCTGG - Intronic
966014689 3:175127280-175127302 CATCCAAGGTACCACAGGCTGGG - Intronic
968979440 4:3838833-3838855 CTCCCTGGGTCCCACTGGCCAGG + Intergenic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969355012 4:6620137-6620159 CTCGCAAGGTCGCACAGGCCGGG - Intronic
969757623 4:9160534-9160556 CTCCCATGGTACTACAGGCCTGG + Intergenic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
971448751 4:26779943-26779965 TTCCCACTCTGCCACAGGCCAGG - Intergenic
971804778 4:31341774-31341796 CTCCCAGGGAACCACCAGCCAGG - Intergenic
976658739 4:87517020-87517042 CTCCCACTATAACACAGGACAGG - Intronic
985627128 5:994950-994972 CTCCGTGGGTACCAGAGGCCAGG + Intergenic
999238291 5:150113092-150113114 CTGCCGGGGTCCCACAGGCCTGG + Intronic
1006517748 6:34554097-34554119 CGCCCACGGTCCCACATGGCGGG + Intronic
1007222433 6:40289631-40289653 CTCCCCTGTTACCACTGGCCAGG - Intergenic
1007697628 6:43743874-43743896 CTCCCAGGGTAGCAGAGGCCAGG - Intergenic
1011708832 6:90030311-90030333 CTCCCAGGGCAGCAGAGGCCTGG - Intronic
1014272486 6:119349649-119349671 GTCCCACGGTCCCGCAGCCCCGG + Exonic
1019431012 7:999743-999765 CGCCCACGTTACTAGAGGCCAGG - Intronic
1020320641 7:6936568-6936590 CTCCCACGGCATCACAGGCCTGG - Intergenic
1022092324 7:27115699-27115721 CTCCCACGGCTCCTCAGGTCTGG - Intronic
1024449901 7:49527770-49527792 GTCCCACAGTTCCACAGGGCTGG + Intergenic
1027024441 7:74840756-74840778 TCCCCACGGGACCACATGCCAGG + Intronic
1027063324 7:75103366-75103388 TCCCCACGGGACCACATGCCAGG - Intronic
1033534697 7:142300898-142300920 CTCCCATGGCCCCACAGGCAAGG - Intergenic
1034159680 7:148983458-148983480 CTCCCACGGTGCCCCCGGCGGGG - Intergenic
1034359646 7:150483066-150483088 CTCCCAGGGCACCACTGGACAGG - Intergenic
1034436546 7:151065285-151065307 CTCCCACTACACCACAGGCAGGG - Intronic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1036848699 8:12186767-12186789 CTCCCACGGTACCACAGGCCTGG - Exonic
1036870060 8:12429048-12429070 CTCCCACGGTACCACAGGCCTGG - Exonic
1038014904 8:23506331-23506353 CTCCCTCGGTAGCCCAGGCTGGG + Intergenic
1038789819 8:30658292-30658314 CTCCCGCGGCACCAGAGGCGGGG - Intergenic
1048861173 8:138725318-138725340 GTCCCCAGGTCCCACAGGCCAGG + Intronic
1049265982 8:141668177-141668199 CTCCCACTGTACCCCAGCCTGGG + Intergenic
1051545142 9:18265208-18265230 ACCCCAAGGTACAACAGGCCTGG - Intergenic
1053646308 9:40121666-40121688 CCCCCCAGGTACCACAGGACAGG + Intergenic
1053759406 9:41341885-41341907 CCCCCCAGGTACCACAGGACAGG - Intergenic
1054327320 9:63719568-63719590 CCCCCCAGGTACCACAGGACAGG + Intergenic
1054538260 9:66254307-66254329 CCCCCCAGGTACCACAGGACAGG - Intergenic
1056326882 9:85487528-85487550 CTCCCACAGTGCCACAGTGCTGG - Intergenic
1056665428 9:88577451-88577473 CTCACATGATACCACAGGCTGGG + Intronic
1060250971 9:121986568-121986590 CTCCCTGGGAACCAAAGGCCAGG + Intronic
1061368366 9:130184299-130184321 CTCTCAGGGACCCACAGGCCTGG + Intronic
1202794098 9_KI270719v1_random:105097-105119 CCCCCCAGGTACCACAGGACAGG + Intergenic
1186785936 X:12955970-12955992 CTCTCAGGGAACCACAAGCCAGG + Intergenic
1189043141 X:37563955-37563977 CCCCCACCGCACGACAGGCCCGG - Intronic
1190617745 X:52253852-52253874 CTCCCACCCCACAACAGGCCCGG - Intergenic
1192074758 X:67982278-67982300 CTCCCACAGGACCTCAGCCCAGG + Intergenic
1196401649 X:115323389-115323411 CTGCCAGATTACCACAGGCCAGG + Intergenic
1201981117 Y:19911333-19911355 CTCCCTTGCTACCATAGGCCTGG + Intergenic