ID: 961891275

View in Genome Browser
Species Human (GRCh38)
Location 3:130132195-130132217
Sequence CCTCCTGGTGTTATTCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961891275_961891281 8 Left 961891275 3:130132195-130132217 CCACAATGAATAACACCAGGAGG No data
Right 961891281 3:130132226-130132248 TTAAAGTCCATTGTGAAGGATGG No data
961891275_961891280 4 Left 961891275 3:130132195-130132217 CCACAATGAATAACACCAGGAGG No data
Right 961891280 3:130132222-130132244 AATATTAAAGTCCATTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961891275 Original CRISPR CCTCCTGGTGTTATTCATTG TGG (reversed) Intergenic
No off target data available for this crispr