ID: 961892843

View in Genome Browser
Species Human (GRCh38)
Location 3:130144903-130144925
Sequence AAGGGCCTAATGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961892843_961892852 18 Left 961892843 3:130144903-130144925 CCCCCAGAGTTCATTAGGCCCTT No data
Right 961892852 3:130144944-130144966 ACGCACTTGAAGGGTTGAAAAGG No data
961892843_961892849 8 Left 961892843 3:130144903-130144925 CCCCCAGAGTTCATTAGGCCCTT No data
Right 961892849 3:130144934-130144956 ATAATGCTCCACGCACTTGAAGG No data
961892843_961892850 9 Left 961892843 3:130144903-130144925 CCCCCAGAGTTCATTAGGCCCTT No data
Right 961892850 3:130144935-130144957 TAATGCTCCACGCACTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961892843 Original CRISPR AAGGGCCTAATGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr