ID: 961894401

View in Genome Browser
Species Human (GRCh38)
Location 3:130155290-130155312
Sequence ATGGCCACATGTTCTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961894401_961894410 14 Left 961894401 3:130155290-130155312 CCCCCAAGAGAACATGTGGCCAT No data
Right 961894410 3:130155327-130155349 TTGGTTGTTGCAGCTGGAGGAGG No data
961894401_961894411 17 Left 961894401 3:130155290-130155312 CCCCCAAGAGAACATGTGGCCAT No data
Right 961894411 3:130155330-130155352 GTTGTTGCAGCTGGAGGAGGTGG No data
961894401_961894406 -5 Left 961894401 3:130155290-130155312 CCCCCAAGAGAACATGTGGCCAT No data
Right 961894406 3:130155308-130155330 GCCATGTCTGGAGACAATTTTGG No data
961894401_961894408 8 Left 961894401 3:130155290-130155312 CCCCCAAGAGAACATGTGGCCAT No data
Right 961894408 3:130155321-130155343 ACAATTTTGGTTGTTGCAGCTGG No data
961894401_961894409 11 Left 961894401 3:130155290-130155312 CCCCCAAGAGAACATGTGGCCAT No data
Right 961894409 3:130155324-130155346 ATTTTGGTTGTTGCAGCTGGAGG No data
961894401_961894412 26 Left 961894401 3:130155290-130155312 CCCCCAAGAGAACATGTGGCCAT No data
Right 961894412 3:130155339-130155361 GCTGGAGGAGGTGGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961894401 Original CRISPR ATGGCCACATGTTCTCTTGG GGG (reversed) Intergenic