ID: 961894407

View in Genome Browser
Species Human (GRCh38)
Location 3:130155309-130155331
Sequence ACCAAAATTGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961894407_961894415 30 Left 961894407 3:130155309-130155331 CCATGTCTGGAGACAATTTTGGT No data
Right 961894415 3:130155362-130155384 CAGCTAATAGGTAGAGGCCACGG No data
961894407_961894412 7 Left 961894407 3:130155309-130155331 CCATGTCTGGAGACAATTTTGGT No data
Right 961894412 3:130155339-130155361 GCTGGAGGAGGTGGTGCTACTGG No data
961894407_961894409 -8 Left 961894407 3:130155309-130155331 CCATGTCTGGAGACAATTTTGGT No data
Right 961894409 3:130155324-130155346 ATTTTGGTTGTTGCAGCTGGAGG No data
961894407_961894411 -2 Left 961894407 3:130155309-130155331 CCATGTCTGGAGACAATTTTGGT No data
Right 961894411 3:130155330-130155352 GTTGTTGCAGCTGGAGGAGGTGG No data
961894407_961894414 24 Left 961894407 3:130155309-130155331 CCATGTCTGGAGACAATTTTGGT No data
Right 961894414 3:130155356-130155378 TACTGGCAGCTAATAGGTAGAGG No data
961894407_961894413 18 Left 961894407 3:130155309-130155331 CCATGTCTGGAGACAATTTTGGT No data
Right 961894413 3:130155350-130155372 TGGTGCTACTGGCAGCTAATAGG No data
961894407_961894410 -5 Left 961894407 3:130155309-130155331 CCATGTCTGGAGACAATTTTGGT No data
Right 961894410 3:130155327-130155349 TTGGTTGTTGCAGCTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961894407 Original CRISPR ACCAAAATTGTCTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr