ID: 961903861

View in Genome Browser
Species Human (GRCh38)
Location 3:130242181-130242203
Sequence AGGTGAGTAAAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961903861_961903867 -3 Left 961903861 3:130242181-130242203 CCTTCTTCCCTCTTTACTCACCT No data
Right 961903867 3:130242201-130242223 CCTCTCCGGTGACATTTCTTGGG No data
961903861_961903868 -2 Left 961903861 3:130242181-130242203 CCTTCTTCCCTCTTTACTCACCT No data
Right 961903868 3:130242202-130242224 CTCTCCGGTGACATTTCTTGGGG No data
961903861_961903865 -4 Left 961903861 3:130242181-130242203 CCTTCTTCCCTCTTTACTCACCT No data
Right 961903865 3:130242200-130242222 ACCTCTCCGGTGACATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961903861 Original CRISPR AGGTGAGTAAAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr