ID: 961903865 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:130242200-130242222 |
Sequence | ACCTCTCCGGTGACATTTCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
961903861_961903865 | -4 | Left | 961903861 | 3:130242181-130242203 | CCTTCTTCCCTCTTTACTCACCT | No data | ||
Right | 961903865 | 3:130242200-130242222 | ACCTCTCCGGTGACATTTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
961903865 | Original CRISPR | ACCTCTCCGGTGACATTTCT TGG | Intergenic | ||
No off target data available for this crispr |