ID: 961903865

View in Genome Browser
Species Human (GRCh38)
Location 3:130242200-130242222
Sequence ACCTCTCCGGTGACATTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961903861_961903865 -4 Left 961903861 3:130242181-130242203 CCTTCTTCCCTCTTTACTCACCT No data
Right 961903865 3:130242200-130242222 ACCTCTCCGGTGACATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961903865 Original CRISPR ACCTCTCCGGTGACATTTCT TGG Intergenic
No off target data available for this crispr