ID: 961903867

View in Genome Browser
Species Human (GRCh38)
Location 3:130242201-130242223
Sequence CCTCTCCGGTGACATTTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961903861_961903867 -3 Left 961903861 3:130242181-130242203 CCTTCTTCCCTCTTTACTCACCT No data
Right 961903867 3:130242201-130242223 CCTCTCCGGTGACATTTCTTGGG No data
961903863_961903867 -10 Left 961903863 3:130242188-130242210 CCCTCTTTACTCACCTCTCCGGT No data
Right 961903867 3:130242201-130242223 CCTCTCCGGTGACATTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961903867 Original CRISPR CCTCTCCGGTGACATTTCTT GGG Intergenic
No off target data available for this crispr