ID: 961903868

View in Genome Browser
Species Human (GRCh38)
Location 3:130242202-130242224
Sequence CTCTCCGGTGACATTTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961903863_961903868 -9 Left 961903863 3:130242188-130242210 CCCTCTTTACTCACCTCTCCGGT No data
Right 961903868 3:130242202-130242224 CTCTCCGGTGACATTTCTTGGGG No data
961903864_961903868 -10 Left 961903864 3:130242189-130242211 CCTCTTTACTCACCTCTCCGGTG No data
Right 961903868 3:130242202-130242224 CTCTCCGGTGACATTTCTTGGGG No data
961903861_961903868 -2 Left 961903861 3:130242181-130242203 CCTTCTTCCCTCTTTACTCACCT No data
Right 961903868 3:130242202-130242224 CTCTCCGGTGACATTTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961903868 Original CRISPR CTCTCCGGTGACATTTCTTG GGG Intergenic
No off target data available for this crispr