ID: 961903868 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:130242202-130242224 |
| Sequence | CTCTCCGGTGACATTTCTTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961903863_961903868 | -9 | Left | 961903863 | 3:130242188-130242210 | CCCTCTTTACTCACCTCTCCGGT | No data | ||
| Right | 961903868 | 3:130242202-130242224 | CTCTCCGGTGACATTTCTTGGGG | No data | ||||
| 961903864_961903868 | -10 | Left | 961903864 | 3:130242189-130242211 | CCTCTTTACTCACCTCTCCGGTG | No data | ||
| Right | 961903868 | 3:130242202-130242224 | CTCTCCGGTGACATTTCTTGGGG | No data | ||||
| 961903861_961903868 | -2 | Left | 961903861 | 3:130242181-130242203 | CCTTCTTCCCTCTTTACTCACCT | No data | ||
| Right | 961903868 | 3:130242202-130242224 | CTCTCCGGTGACATTTCTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961903868 | Original CRISPR | CTCTCCGGTGACATTTCTTG GGG | Intergenic | ||
| No off target data available for this crispr | |||||