ID: 961904345

View in Genome Browser
Species Human (GRCh38)
Location 3:130247033-130247055
Sequence CTTTGGGGCCCTTTATACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961904345_961904351 -5 Left 961904345 3:130247033-130247055 CCAGGGTATAAAGGGCCCCAAAG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 961904351 3:130247051-130247073 CAAAGGTTTGGTAGATATGACGG 0: 1
1: 0
2: 0
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961904345 Original CRISPR CTTTGGGGCCCTTTATACCC TGG (reversed) Intergenic
900382068 1:2389802-2389824 CTTTCGAGCCCATTGTACCCTGG - Intronic
902249802 1:15146867-15146889 CTTTGGGCCCCTCTGTCCCCAGG + Intergenic
908740209 1:67319700-67319722 CTTTGGGGTCCTTTAGAACTGGG - Intronic
917095017 1:171391247-171391269 ATATGAGGCCCTTCATACCCTGG + Intergenic
919822885 1:201484049-201484071 CTTTGGGGTCCTTAAGACCTGGG + Exonic
921257234 1:213353624-213353646 CTTTCTGGCTCTTTCTACCCAGG + Intergenic
922579210 1:226684787-226684809 CTTTGGGGCCCTCTGTACTTGGG - Intronic
924858919 1:247901229-247901251 CATGGGGGGCCTTTATATCCAGG + Intergenic
924908417 1:248482009-248482031 CTTTGGGGCCCTTCACTCTCTGG + Intergenic
924915693 1:248566076-248566098 CTTTGGGGCCCTTCACTCTCTGG - Intergenic
1067248274 10:44565020-44565042 CTCTGGGGCCCTTTACCCCATGG + Intergenic
1067957728 10:50810855-50810877 ATTTGGGGGCCTTTATATGCTGG + Intronic
1075669353 10:124253348-124253370 CTCTGGAGCAATTTATACCCTGG + Intergenic
1078874402 11:15378896-15378918 CTTTGGGGCTCTGTATTTCCTGG + Intergenic
1079124237 11:17707676-17707698 CTTCAGGCCCCTTTATGCCCAGG - Intergenic
1080614866 11:33937132-33937154 CTATGAGGCCCTTTATCACCGGG - Intergenic
1090409071 11:126495291-126495313 CTTCCGGGCCCTCTGTACCCTGG + Intronic
1090913175 11:131139689-131139711 CTTTCAGTTCCTTTATACCCAGG - Intergenic
1094034535 12:26053629-26053651 CTTTGGAAGCCTTTATCCCCAGG + Intronic
1094264763 12:28544139-28544161 CTTTAGGGCCCTTTATGCTCTGG + Intronic
1094575635 12:31682561-31682583 ATTTGGGGTCTTTTATAGCCTGG + Intronic
1095982837 12:47982676-47982698 GTTTGGGGCCCTGGTTACCCAGG - Intronic
1103190067 12:118993620-118993642 TTTGGGGGCCATTTATAACCAGG - Intronic
1103924563 12:124416454-124416476 CTTTGGGGCCTTTTATTCTACGG + Intronic
1107106418 13:36648045-36648067 GTTTGGGGCCCTTGATATCAAGG + Intergenic
1110290083 13:73795329-73795351 CTTTGGTGTCCATTATACCTAGG - Intronic
1110810756 13:79808500-79808522 CTTTGGGGCCCTGCATTTCCTGG + Intergenic
1117814866 14:59586904-59586926 CTTTAGGGACCTTTATATCATGG - Intergenic
1120405149 14:84084847-84084869 TTTTGGGTCTCTTTATACCTTGG + Intergenic
1121661362 14:95637666-95637688 CTTTAAGGCCCTTTATGACCTGG - Intergenic
1127899359 15:63329765-63329787 CCTTGGGGCCCTTAACAGCCTGG + Intronic
1130907867 15:88252762-88252784 CTTTTGGCCCCTTTCTGCCCAGG - Intronic
1130976863 15:88783133-88783155 TTTTGGAGCCCTTGATGCCCCGG - Intergenic
1131573117 15:93559369-93559391 CTTTGGGCCAATTGATACCCTGG + Intergenic
1134809221 16:17152964-17152986 CTTTTGGGCCCTTTATAAGTGGG - Intronic
1138274827 16:55726331-55726353 CTGTAGGGTCCTTTGTACCCTGG - Intergenic
1138957126 16:61984976-61984998 TTTTGGGGCCTTTTAAATCCAGG + Intronic
1140656863 16:77150116-77150138 CTTTGGTGCCCTTTTCCCCCTGG - Intergenic
1140917439 16:79506825-79506847 CTTTGGGGCTCTTTCTGACCTGG - Intergenic
1146374444 17:32284825-32284847 CTCTGGGGCCCTTGGTACTCGGG + Intronic
1146974429 17:37098803-37098825 CTTTGGAACCCCTTATACCAAGG + Intronic
1149578232 17:57728851-57728873 CCATGGGGCCCTTTAGATCCAGG + Intergenic
1152995554 18:403059-403081 CTTTGGGATCCTTAATACGCTGG - Intronic
1156491870 18:37501138-37501160 CTGTGGGGGCCTTTGTGCCCAGG - Intronic
1156986991 18:43360490-43360512 CATTGGGTCCCTTCCTACCCAGG + Intergenic
1166936256 19:46334998-46335020 CTCTGGGGCTCTGGATACCCAGG - Intronic
926320134 2:11743694-11743716 CTTTGGGATCCTTTCTGCCCGGG + Intronic
926500639 2:13648942-13648964 CTGTGGAGCCCTTTTGACCCTGG + Intergenic
926739445 2:16099128-16099150 CTTTGGGGCTCTTCATATCAAGG - Intergenic
928595491 2:32855676-32855698 CTATGGGGCCCTTTATTTCTGGG + Intergenic
930191764 2:48466888-48466910 CTTAGGGGCCTTTTAGAACCTGG - Intronic
932816061 2:74863146-74863168 CTCTGGTGCTCTTTTTACCCAGG - Intronic
934928334 2:98397773-98397795 CTTTGGGGCCCTAGAAACCCTGG + Exonic
935873402 2:107477453-107477475 CTATGAGGCCATTTTTACCCTGG + Intergenic
937395855 2:121534144-121534166 CCCTGGGGCCATTTATACACTGG + Intronic
940379654 2:152999578-152999600 CTTTGGCTCTGTTTATACCCTGG - Intergenic
941182895 2:162283061-162283083 GTTTGCAGCCCTTTATAACCTGG - Intronic
1170043760 20:12064849-12064871 CTTTGGGGCCCTGCAGTCCCTGG - Intergenic
1171167445 20:22984458-22984480 CTTTGGTCTCCTTTGTACCCTGG + Intergenic
1171520873 20:25773111-25773133 TTTTGGGGCCTGTTGTACCCTGG - Intronic
1171556051 20:26083380-26083402 TTTTGGGGCCTGTTGTACCCTGG + Intergenic
1172688485 20:36774483-36774505 CTTTGAGGCGCTATATTCCCAGG + Intergenic
1178078871 21:29041270-29041292 CCTTGGTGCCCTTTAGAGCCTGG + Intronic
1179321239 21:40293175-40293197 CTTACGGACCCTTTATAGCCAGG + Intronic
1179726120 21:43342006-43342028 CTCTGGGTCCCTTTATACCTGGG + Intergenic
1179943484 21:44654672-44654694 CTTAGGTGGCCTTTATACCCAGG + Intronic
1179944078 21:44658810-44658832 CTCTGGTGGTCTTTATACCCGGG - Intronic
1180988069 22:19917281-19917303 CTGTGGGGCTCTGTATCCCCTGG - Intronic
1181786605 22:25231682-25231704 CTTTGGGGCCCCTCACCCCCAGG + Exonic
1182245833 22:28956808-28956830 CTCTGGGACTGTTTATACCCAGG - Intronic
1184268144 22:43361200-43361222 CTTTCTGGCCATTTTTACCCTGG - Intergenic
953614516 3:44477903-44477925 CTTTGGATCCCTTTCTTCCCTGG - Intergenic
954862648 3:53703528-53703550 CTCTGGGGCCCTTTGTGCCTCGG + Intronic
954982830 3:54761689-54761711 CTTTGGGGCCCTGTTTCCCCTGG + Intronic
957555617 3:81761661-81761683 GTCCGGGGCCCTTTATAGCCGGG + Exonic
958797900 3:98725911-98725933 CTTTGGGGCCCTTTTTATAAGGG + Intergenic
958907975 3:99962589-99962611 CTTTGGTGGCTTTTATACACAGG + Intronic
960141336 3:114154446-114154468 CTCTGGGGCTCATTAAACCCAGG - Intronic
960610318 3:119549487-119549509 CTTCTGGGCCCTGTATCCCCTGG + Intronic
961155477 3:124676042-124676064 CTTTGAGGGCCTTTATCCCAAGG - Intronic
961904345 3:130247033-130247055 CTTTGGGGCCCTTTATACCCTGG - Intergenic
963001266 3:140684059-140684081 CTTTAGTGCCCTTTACCCCCAGG + Intronic
963086205 3:141438777-141438799 CTTTAGGGCCCTTTATGATCTGG + Intronic
968655809 4:1778001-1778023 CTTTCTGGCCCTTTCTGCCCTGG - Intergenic
971327342 4:25655325-25655347 CTGTGGGGCGCTTTCTGCCCTGG - Intronic
976513426 4:85936440-85936462 CTTTGGAGTCCTTTATACCTGGG + Intronic
977112567 4:92977492-92977514 CTTTGAAGCCCTTCATGCCCTGG + Intronic
982602641 4:157470762-157470784 CTATGGAGCCCTATCTACCCTGG - Intergenic
990456162 5:55990485-55990507 CTTTGGGTACCTTCATAGCCTGG - Intronic
998014040 5:138718164-138718186 CTTCATGGCCTTTTATACCCTGG + Intronic
998173125 5:139883901-139883923 CTTAGGGGTCCATAATACCCAGG + Intronic
1002517689 5:179771889-179771911 CTCTGGGACCCTTTATAGCAAGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002772423 6:301252-301274 GTTTGGGGTCCTTTATCCCTTGG - Intronic
1003394284 6:5740035-5740057 CTCTGGGGGCCTTTAAACCTCGG - Intronic
1006144046 6:31947640-31947662 CTTCTGAGCCTTTTATACCCTGG + Intronic
1009921592 6:70068428-70068450 CTTGGGGGCCTTGTATCCCCAGG - Exonic
1015257923 6:131200557-131200579 CTTTTGGGCCCTTTAAATCATGG + Intronic
1025022746 7:55492589-55492611 CTCTTGGGCCCATTTTACCCAGG + Intronic
1025281354 7:57628074-57628096 TCTTGGGGCCCGTTGTACCCCGG - Intergenic
1025303375 7:57837433-57837455 TCTTGGGGCCCGTTGTACCCCGG + Intergenic
1026894687 7:74003228-74003250 GTTTGGGGCCCTCTCTCCCCTGG - Intergenic
1032316584 7:130843806-130843828 CTGTGGGGCACATTATGCCCTGG - Intergenic
1033433910 7:141314906-141314928 CTTAGTGGCCATTTCTACCCAGG + Intronic
1033547543 7:142415241-142415263 CTGTGTGTCCCTTTATATCCTGG + Intergenic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1033608006 7:142941510-142941532 CCTTGGGGCACTTGATCCCCTGG - Intronic
1036686002 8:10910695-10910717 CTCCTGGGCCCTTTAAACCCTGG - Intronic
1038252106 8:25914461-25914483 CTTCAGGGCCCTTTGTAGCCTGG - Intronic
1042126002 8:65537638-65537660 TTTTGGGGTACTTTATACCTCGG + Intergenic
1043238371 8:77899175-77899197 CTTTGGGCCTCTCTATTCCCTGG - Intergenic
1045768476 8:105705720-105705742 CTTTGGGTCCATTTTCACCCAGG - Intronic
1047831024 8:128629969-128629991 TTTTGCAGCCTTTTATACCCTGG - Intergenic
1047977597 8:130146426-130146448 CTTTGGAGCCAGTTAAACCCAGG - Intronic
1053310960 9:37019431-37019453 CTTTGGGGACCTTGATCCCAGGG - Intronic
1056286629 9:85093600-85093622 CTTGGGGGCCCTACAGACCCAGG - Intergenic
1059001675 9:110355138-110355160 CATTGGGCACTTTTATACCCTGG + Intergenic
1060522039 9:124299475-124299497 TCCTGGGGCTCTTTATACCCTGG + Intronic
1060803073 9:126556910-126556932 CTTTGGGGGCCGCTATTCCCAGG - Intergenic
1062361727 9:136191505-136191527 CTCTGGGGCCTTTTCTGCCCAGG + Intergenic
1186956226 X:14685088-14685110 CTTTGGTTCCATTTATACGCTGG + Intronic
1189337598 X:40179721-40179743 CTTGGGGGCCCCTTGTATCCGGG - Intergenic
1192347240 X:70321096-70321118 CTTCCAGACCCTTTATACCCTGG + Intronic
1199212678 X:145232507-145232529 CTTTGGGGACCTTTCCTCCCTGG + Intergenic