ID: 961905836

View in Genome Browser
Species Human (GRCh38)
Location 3:130262149-130262171
Sequence AGGTTTAACCAGATGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961905836_961905840 25 Left 961905836 3:130262149-130262171 CCCTTCTGCATCTGGTTAAACCT No data
Right 961905840 3:130262197-130262219 CAATGCAGAAAATAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961905836 Original CRISPR AGGTTTAACCAGATGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr