ID: 961905840

View in Genome Browser
Species Human (GRCh38)
Location 3:130262197-130262219
Sequence CAATGCAGAAAATAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961905839_961905840 -5 Left 961905839 3:130262179-130262201 CCTTAGAATAATGTTTTTCAATG No data
Right 961905840 3:130262197-130262219 CAATGCAGAAAATAAAAAACAGG No data
961905836_961905840 25 Left 961905836 3:130262149-130262171 CCCTTCTGCATCTGGTTAAACCT No data
Right 961905840 3:130262197-130262219 CAATGCAGAAAATAAAAAACAGG No data
961905838_961905840 5 Left 961905838 3:130262169-130262191 CCTATGCTCTCCTTAGAATAATG No data
Right 961905840 3:130262197-130262219 CAATGCAGAAAATAAAAAACAGG No data
961905837_961905840 24 Left 961905837 3:130262150-130262172 CCTTCTGCATCTGGTTAAACCTA No data
Right 961905840 3:130262197-130262219 CAATGCAGAAAATAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961905840 Original CRISPR CAATGCAGAAAATAAAAAAC AGG Intergenic
No off target data available for this crispr