ID: 961906888

View in Genome Browser
Species Human (GRCh38)
Location 3:130272227-130272249
Sequence CCAGATGTACTGTACCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961906888_961906895 24 Left 961906888 3:130272227-130272249 CCCTGTGGGTACAGTACATCTGG No data
Right 961906895 3:130272274-130272296 GTGCCGATTATACTATTGGGAGG No data
961906888_961906893 20 Left 961906888 3:130272227-130272249 CCCTGTGGGTACAGTACATCTGG No data
Right 961906893 3:130272270-130272292 GTCTGTGCCGATTATACTATTGG No data
961906888_961906894 21 Left 961906888 3:130272227-130272249 CCCTGTGGGTACAGTACATCTGG No data
Right 961906894 3:130272271-130272293 TCTGTGCCGATTATACTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961906888 Original CRISPR CCAGATGTACTGTACCCACA GGG (reversed) Intergenic
No off target data available for this crispr