ID: 961907556 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:130278053-130278075 |
| Sequence | TTAGGCTACCAATTGAATCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961907556_961907558 | 11 | Left | 961907556 | 3:130278053-130278075 | CCATGATTCAATTGGTAGCCTAA | No data | ||
| Right | 961907558 | 3:130278087-130278109 | AAATGTGTTTTGAACTGATTTGG | No data | ||||
| 961907556_961907559 | 22 | Left | 961907556 | 3:130278053-130278075 | CCATGATTCAATTGGTAGCCTAA | No data | ||
| Right | 961907559 | 3:130278098-130278120 | GAACTGATTTGGCATCTGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961907556 | Original CRISPR | TTAGGCTACCAATTGAATCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||