ID: 961907556

View in Genome Browser
Species Human (GRCh38)
Location 3:130278053-130278075
Sequence TTAGGCTACCAATTGAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961907556_961907558 11 Left 961907556 3:130278053-130278075 CCATGATTCAATTGGTAGCCTAA No data
Right 961907558 3:130278087-130278109 AAATGTGTTTTGAACTGATTTGG No data
961907556_961907559 22 Left 961907556 3:130278053-130278075 CCATGATTCAATTGGTAGCCTAA No data
Right 961907559 3:130278098-130278120 GAACTGATTTGGCATCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961907556 Original CRISPR TTAGGCTACCAATTGAATCA TGG (reversed) Intergenic
No off target data available for this crispr