ID: 961909788

View in Genome Browser
Species Human (GRCh38)
Location 3:130302535-130302557
Sequence GACCCCATTCCTGGTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961909788_961909798 17 Left 961909788 3:130302535-130302557 CCAGTACCACCAGGAATGGGGTC No data
Right 961909798 3:130302575-130302597 GTCAAACCTGTGTTCATTGTGGG No data
961909788_961909801 30 Left 961909788 3:130302535-130302557 CCAGTACCACCAGGAATGGGGTC No data
Right 961909801 3:130302588-130302610 TCATTGTGGGAGGTAGCTGATGG No data
961909788_961909797 16 Left 961909788 3:130302535-130302557 CCAGTACCACCAGGAATGGGGTC No data
Right 961909797 3:130302574-130302596 AGTCAAACCTGTGTTCATTGTGG No data
961909788_961909799 20 Left 961909788 3:130302535-130302557 CCAGTACCACCAGGAATGGGGTC No data
Right 961909799 3:130302578-130302600 AAACCTGTGTTCATTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961909788 Original CRISPR GACCCCATTCCTGGTGGTAC TGG (reversed) Intergenic
No off target data available for this crispr