ID: 961910261

View in Genome Browser
Species Human (GRCh38)
Location 3:130307603-130307625
Sequence CAGGGAGAAGAATGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961910251_961910261 8 Left 961910251 3:130307572-130307594 CCATAAGAATGATGTAATGGACT No data
Right 961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961910261 Original CRISPR CAGGGAGAAGAATGGGAGGA GGG Intergenic
No off target data available for this crispr