ID: 961915971

View in Genome Browser
Species Human (GRCh38)
Location 3:130375511-130375533
Sequence GGGAGAACAGAGTCTAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961915971 Original CRISPR GGGAGAACAGAGTCTAAGAT GGG (reversed) Intronic
901575985 1:10201254-10201276 TGGAGAACAGAGTCGTCGATGGG + Intergenic
901827634 1:11872750-11872772 GTGAGGACAGAGTCAGAGATGGG - Intergenic
902643271 1:17780318-17780340 GGGAGAACTGAGGCTCAGAGAGG + Intronic
902725870 1:18335541-18335563 GGGAAAACTGAGTCTGGGATGGG - Intronic
904549509 1:31303967-31303989 GTGAGGTCAGAGTCTAAGCTGGG - Intronic
904566086 1:31429177-31429199 GGGAGGACTGAGTCTCAGAATGG - Intronic
906271910 1:44486062-44486084 GGGAGAAAAGAGTCAGAGAAAGG - Intronic
907425413 1:54376134-54376156 GGGAGACCAGAGACTAAGGGAGG - Intronic
911235972 1:95412726-95412748 GAGAGAACAGGGTGGAAGATAGG + Intergenic
911992054 1:104711480-104711502 TGGAGAACAGAGCCTAAAATAGG - Intergenic
913199848 1:116486925-116486947 GGGTGACCAGAGTCTTGGATGGG - Intergenic
914864392 1:151414341-151414363 GGGAAAACATAGACTAAGAAAGG - Intronic
916355273 1:163899034-163899056 AGGAATACAGAGTCTAAGAAAGG + Intergenic
917600699 1:176570939-176570961 GGGAGAACAGTGTGGAAGAGAGG - Intronic
917622101 1:176807045-176807067 GAGAAAACTCAGTCTAAGATAGG + Intronic
920339608 1:205267718-205267740 AGGAGAAGAGAGACTAAGAAAGG - Intronic
921388004 1:214590236-214590258 GGGAGTACAGAATATAAGGTTGG - Intergenic
921622444 1:217340736-217340758 TGGAGTACAGAGTTTAAGCTGGG - Intergenic
921796684 1:219352773-219352795 GGATGAACAGAGCCTAAGCTGGG - Intergenic
922812096 1:228422456-228422478 TGAAGAACAGAGTCTAAGTTGGG - Intergenic
1064997382 10:21308193-21308215 GTGACAACAGAGTCTCAGAAGGG + Intergenic
1065992279 10:31023878-31023900 GGAAGCACAGAGTTTGAGATTGG - Intronic
1066492775 10:35909874-35909896 AGGAAAAAAGAGTCTGAGATTGG - Intergenic
1069606833 10:69744073-69744095 GGGAGAACAGAGCAAAAGGTGGG + Intergenic
1071811382 10:89185597-89185619 GGGAGACCACATTTTAAGATAGG + Intergenic
1072087111 10:92090792-92090814 CGGAGAATAAAGTCTAAGAAGGG - Intronic
1074040777 10:109786140-109786162 GAGAGGACAGAATCTAGGATGGG + Intergenic
1075251574 10:120880712-120880734 AGGAGAACAGAGGGTAGGATGGG + Intronic
1075389138 10:122079769-122079791 TGGAGAACAGAGGCTAAGCATGG - Intronic
1078527120 11:12109977-12109999 GGCAGAGCAGAGATTAAGATAGG + Intronic
1079252617 11:18798085-18798107 AGGAGAACAGAGTGAAAGATTGG + Intergenic
1080247189 11:30192823-30192845 GGGAGAACAGGTTCAAGGATAGG + Intergenic
1080411215 11:32026793-32026815 GGGAGAACAGGAGATAAGATTGG + Intronic
1080746425 11:35112253-35112275 GAGAAAACAGAGGCTAAGAAAGG + Intergenic
1081507825 11:43736419-43736441 GGGAGTAAAGAGTCGAAGAGAGG + Intronic
1081824529 11:46035722-46035744 AGGAGAACAGTGTCTCAGAAGGG + Intronic
1083158738 11:60841773-60841795 GAGAGAACAGAGTCGAAAAAAGG - Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084509430 11:69593934-69593956 TGGAGAACAGATCCTAAGTTGGG + Intergenic
1084692734 11:70736510-70736532 GGGAGAACAGAGGCAGAGATGGG + Intronic
1084765399 11:71305156-71305178 GTGAGGACAGAGGCCAAGATTGG + Intergenic
1086052581 11:82611001-82611023 GGGAGAAGAAAATATAAGATAGG + Intergenic
1087105085 11:94400677-94400699 GGGAGAAAAGAGACTAGGACAGG + Intronic
1087307365 11:96502350-96502372 GGGAGAGTAGAGTATATGATTGG - Intronic
1090002826 11:122977292-122977314 GGGAGAAAGGGGTCTATGATCGG + Intergenic
1090369716 11:126240545-126240567 GGGAAAACTGATTTTAAGATTGG + Intronic
1091991788 12:4961372-4961394 GGGAGCACAGAGTCTAGGGGAGG + Intergenic
1092788219 12:12049114-12049136 GTGAGAAGAGAGTCAGAGATGGG - Intergenic
1093291265 12:17325210-17325232 AAGAGAACAGAGTCTCAGAAAGG - Intergenic
1094426561 12:30322465-30322487 GGGAGAAAAGACTTTAAGAAGGG + Intergenic
1095450570 12:42326405-42326427 GGAAGTATTGAGTCTAAGATAGG + Intronic
1096742020 12:53700545-53700567 GGGAGAACAAAATCTCAGAGAGG + Intergenic
1097616412 12:61889341-61889363 CGCAGAACAGATTCTAAGAGAGG - Intronic
1097962694 12:65547857-65547879 TGGATAACAGAGTCTGAGTTTGG + Intergenic
1101236385 12:102794301-102794323 GGGAGAACTGAATCTCAGAGAGG - Intergenic
1102864191 12:116361147-116361169 GGGAGAACTGAGGCTCAGAAAGG - Intergenic
1102888816 12:116542251-116542273 TGGAGAACAGAGGCAAAGAGAGG + Intergenic
1103182223 12:118923443-118923465 GGGAGAACTGAGGCTCAGAGAGG + Intergenic
1104748768 12:131225406-131225428 GGGAGAACAGAGAGGAAAATGGG - Intergenic
1104784355 12:131440158-131440180 GGGAGAACAGAGAGGAAAATGGG + Intergenic
1105417337 13:20224843-20224865 GGGATAAGAAAGTCTAAGACCGG - Intronic
1105829773 13:24153722-24153744 AGGAGAACAGAGTCTAAAAGAGG + Intronic
1107126038 13:36847995-36848017 GTAAAAACAGAGTCTAATATGGG - Exonic
1109219640 13:59628280-59628302 TGGACTACAGAGTCTAAGTTGGG + Intergenic
1110281249 13:73696638-73696660 TGGTGAAAAGAGCCTAAGATAGG + Intronic
1112890938 13:104230659-104230681 ATGAGAACAGAGTTTAAAATAGG - Intergenic
1113188555 13:107717772-107717794 GGATAAACAGAGGCTAAGATTGG - Intronic
1113520034 13:110934051-110934073 GGGAGAACAGAACCACAGATTGG - Intergenic
1114666787 14:24382254-24382276 GTGACAACAGAGGCCAAGATTGG - Intergenic
1114840443 14:26256718-26256740 GGGAGGAATGAGTCTAGGATGGG + Intergenic
1115370838 14:32612488-32612510 GGAAGAACAGATGTTAAGATGGG - Intronic
1118320848 14:64752536-64752558 GGGATAACAGAGTCTCGGAAAGG - Intronic
1118916626 14:70112844-70112866 GTGAGAACAGAGACAAAGACTGG - Intronic
1119161707 14:72458321-72458343 GTGAGAACATGGTCTGAGATTGG - Exonic
1122318993 14:100842017-100842039 GGCAAAGCTGAGTCTAAGATGGG - Intergenic
1124514294 15:30353028-30353050 GGGAGCACAGAGTCTGAAAGGGG + Intergenic
1124728625 15:32177736-32177758 GGGAGCACAGAGTCTGAAAGGGG - Intergenic
1124892455 15:33745724-33745746 GGAAGAACAGAGGCTAGGACTGG - Intronic
1128815350 15:70604256-70604278 GGGAAAACAAACTCTTAGATTGG - Intergenic
1129088642 15:73124498-73124520 GGGAGAAAAGAGTAGGAGATGGG - Intronic
1129298026 15:74610436-74610458 GGCAGCACAGAGCCTCAGATAGG + Intronic
1129515792 15:76156564-76156586 GGGAGAAGAGAGGCTCAGAGTGG - Intronic
1131295842 15:91148466-91148488 GGGGGAACCCAGACTAAGATGGG - Intronic
1132686101 16:1162764-1162786 GGGAGGACAGTGTCCAAGCTGGG + Intronic
1133771136 16:8867799-8867821 GGGAGAACAGAGGCAGAGAGAGG + Intronic
1134127386 16:11625610-11625632 GGGGGAACCAAGTCTAAGACAGG + Intronic
1134349934 16:13427625-13427647 GGAAGAACAGAGGATAAGTTGGG + Intergenic
1134908543 16:18003293-18003315 TGGAGAACAGAGGATGAGATAGG - Intergenic
1136561128 16:31039875-31039897 GGGAGAACAGGGTCTGAGGGAGG - Intronic
1141340524 16:83199820-83199842 GGGAGAACTGAGGCTTAGAGGGG + Intronic
1142544557 17:690805-690827 GGAAGAACAGTGTCTAAAATCGG + Intronic
1143523668 17:7460761-7460783 TGGGGAACTGAGTCAAAGATGGG + Exonic
1144295970 17:13875450-13875472 GGGGGAACAGAGGCTCAGAAAGG - Intergenic
1147338162 17:39739206-39739228 GGGAGAGCAGAGTCCAAGACCGG - Intronic
1148575368 17:48706820-48706842 GAGAGAACAGAGTGAAATATGGG - Intergenic
1148643656 17:49206585-49206607 GGGAGAAAAGAGTTGAAGGTGGG + Exonic
1148677959 17:49455883-49455905 GGGAGAACAGAGGCCCAGAGTGG - Intronic
1149559081 17:57595398-57595420 GGGAGAAGAGTGTCTTAGCTGGG + Intronic
1151597032 17:75084506-75084528 GGGGGAACAGACCCTAAGGTTGG + Intergenic
1152052161 17:77988457-77988479 GTGAGAACAGATTCACAGATGGG - Intergenic
1153748608 18:8206912-8206934 GGGAGGACAGAGGCAGAGATTGG + Intronic
1153749031 18:8210386-8210408 GGGAGGACAGAGGCAGAGATTGG + Intronic
1154088736 18:11336300-11336322 TAGAGAACAGATTCTATGATGGG + Intergenic
1155554563 18:27004159-27004181 GGAAGAACAGAATGAAAGATAGG + Intronic
1157874504 18:51259943-51259965 GGGAAAACCCAGTCTAAGACAGG - Intergenic
1158493254 18:57929348-57929370 GGGACAACAGAGGCAGAGATTGG + Intergenic
1158608662 18:58918991-58919013 TGGAAAACAGAGTCCTAGATGGG + Exonic
1159152877 18:64542824-64542846 TGGAAAACAGAATCTAAGATAGG - Intergenic
1159942987 18:74422789-74422811 TGGAGAACAGAGTCCAAGGATGG + Intergenic
1160461220 18:79040090-79040112 GAGACAACAGAGTGCAAGATAGG - Intergenic
1164633909 19:29778966-29778988 AGGAGAACAGAGACCAAGAAAGG + Intergenic
1164676244 19:30103717-30103739 GGGAACACTGAGTATAAGATGGG + Intergenic
1165197078 19:34112345-34112367 TAGGGAACAGATTCTAAGATGGG + Intergenic
1165474710 19:36023923-36023945 GGGAGAAAGGAGTCTCAGCTTGG - Intronic
1165507044 19:36240042-36240064 GGGAAAACAGAGAAAAAGATGGG - Intronic
1166343068 19:42150269-42150291 GGGAGCACAGAGGCCTAGATGGG + Intronic
1167660248 19:50792047-50792069 GGGAAAACTGAGTCTCAGAGAGG - Intronic
1167701725 19:51052001-51052023 GGGAGGACAGAGTGAAAGATTGG - Intergenic
1167822516 19:51941488-51941510 GGGGGCACAGAGTCCAAGATAGG - Intronic
926739847 2:16102237-16102259 GGGAGACAGGAGTCTAAGAAGGG - Intergenic
931760761 2:65414805-65414827 GGGAGAACAGAGTTGCAGAGGGG + Intronic
932500175 2:72176330-72176352 GGGAGAAGGGAGGCTAAGGTAGG + Exonic
933347042 2:81101219-81101241 GGGAGAAAATACTCAAAGATTGG - Intergenic
933426571 2:82120519-82120541 TAGAGAACAGTGTGTAAGATTGG + Intergenic
934277220 2:91584454-91584476 GTGACAACAGAGGCAAAGATTGG + Intergenic
934301031 2:91776175-91776197 GGGAAAACTGAGTCTCAGAGGGG - Intergenic
935052737 2:99537125-99537147 TGGAGAACAGAGACTGAGAATGG + Intergenic
938595898 2:132786932-132786954 GGGAGAAGAGGGGCTAAGCTTGG - Intronic
940779714 2:157919573-157919595 TGGAGAACAGAGGCTCAGAGAGG - Intronic
940926739 2:159371708-159371730 TGGAGAACAGAGACTAATTTTGG - Intronic
942717245 2:178907269-178907291 GGGAAAACTGAGTCTCAGAGAGG + Intronic
943102548 2:183505800-183505822 GGGAGAACAGAGTCAGAAATAGG - Intergenic
943502030 2:188703604-188703626 GAAAAAACAGAGTCTAAGAAAGG + Intergenic
944863728 2:203840280-203840302 GGGGGAACAGTGTATAAAATAGG + Intergenic
945548592 2:211190017-211190039 TGGAGAACAGAGATTAATATAGG - Intergenic
946079597 2:217106208-217106230 GGGAGAAGAGAGGCAAGGATGGG + Intergenic
946938453 2:224746175-224746197 TAGGGAACAGAGTCTAAGAGTGG - Intergenic
949052217 2:241903413-241903435 AGGAGAACAGAGTCAAAGACAGG - Intergenic
1168980477 20:1999260-1999282 TGGAGCACAGAGTGAAAGATGGG + Intergenic
1169491601 20:6076026-6076048 GGGAGAAAAAAGTCTATTATTGG + Exonic
1170386582 20:15825066-15825088 GTGAGAACATTGTCAAAGATTGG - Intronic
1171216600 20:23356887-23356909 GGGAGAACAGGGGCTAGGGTGGG + Intergenic
1171784730 20:29451986-29452008 GGGAGGACAGAGTGAAAGATTGG - Intergenic
1172047324 20:32089718-32089740 GGGAAAACAGAGTGTAAGGACGG + Intronic
1173522400 20:43709770-43709792 GGGAGAGGGGAGTCTAAGAGGGG - Intronic
1173848840 20:46205111-46205133 GGGGGAAAAGAGTCACAGATAGG - Intronic
1174387514 20:50196088-50196110 GGGAGAAAACAGTCTCAGAGAGG - Intergenic
1174569503 20:51491794-51491816 GGGAGAAGAGAGTAAGAGATGGG - Intronic
1174581370 20:51574130-51574152 GGGAGAGCAGGTTCTAGGATGGG + Intergenic
1175689744 20:61056834-61056856 GGCTGCAGAGAGTCTAAGATAGG - Intergenic
1177016389 21:15794277-15794299 GGGGGAACAGAATGTAAGAAAGG + Intronic
1177185048 21:17784147-17784169 GAGAAAACAGAGGCTAAGAGAGG + Intergenic
1180731156 22:17983549-17983571 GGGAGTACAGAGTCAGAGTTTGG - Intronic
1181598598 22:23935446-23935468 GCCAGAACAGAGGCAAAGATTGG - Intergenic
1182544077 22:31063033-31063055 GTGAGAACTGTATCTAAGATGGG + Intergenic
1182765460 22:32754885-32754907 GAGAGAAGAGTGACTAAGATAGG - Intronic
1183540948 22:38429155-38429177 GGGAGAGAAGAGTCTAAGAAAGG - Intronic
1183646347 22:39129159-39129181 ATGAGAACAGAGTCTAAGGCAGG - Intronic
949817185 3:8070839-8070861 GGGAAAACTGAGGCTCAGATGGG - Intergenic
950439561 3:13001347-13001369 GGGAGAGCAGAGTTCCAGATAGG - Intronic
953744879 3:45566750-45566772 AGGAGAACAGAGAGCAAGATGGG + Intronic
955992184 3:64640369-64640391 GTGAGAAAAGAGTCTAATATTGG - Intronic
956712714 3:72052164-72052186 GGGAGGTCATAGTCTAAGAAGGG - Intergenic
959210494 3:103373593-103373615 GGGAGAATATAGTCTCAGAAAGG - Intergenic
959945703 3:112123463-112123485 GGGAAAACTGAGTCTCAGAAGGG + Exonic
961643346 3:128378970-128378992 GGGAGAAAAGAGTTGAAGAGAGG + Intronic
961915971 3:130375511-130375533 GGGAGAACAGAGTCTAAGATGGG - Intronic
963078193 3:141367512-141367534 AGGAGAAAAGAGACAAAGATGGG - Intronic
969033523 4:4231908-4231930 GTGACAACAGAGGCAAAGATTGG - Intergenic
969041930 4:4305515-4305537 GACAGAACAGATTCTAAGAATGG - Intronic
969235186 4:5860540-5860562 GGGAGAATAGAGGCTCAGAGAGG - Intronic
969316148 4:6382410-6382432 GGGAGAACAGAGGCTGGGACAGG - Intronic
970286372 4:14520965-14520987 GCGAAAGCAGAGTCTAACATAGG - Intergenic
971151251 4:24034012-24034034 GGGTGAGCAGAGTCTTGGATAGG + Intergenic
971591871 4:28479153-28479175 TGGAGAACACTGACTAAGATAGG - Intergenic
973050564 4:45590888-45590910 GAGATAACAGATTCTAAGACAGG + Intergenic
973786277 4:54335591-54335613 GAGAAAACAGAGGCTAAGAGAGG + Intergenic
977354539 4:95928385-95928407 TCAAGAACAAAGTCTAAGATAGG + Intergenic
982441226 4:155438622-155438644 GCTAGAACAGAGTCAAAAATGGG - Intergenic
983375659 4:166924253-166924275 GGCAGAAAAGAGTCTTTGATAGG - Intronic
986419831 5:7568542-7568564 GTGAAAACAGAGTCCAAGATGGG + Intronic
986836667 5:11646730-11646752 GGAAGAACAGGGTCTTAGAGAGG - Intronic
987126441 5:14817501-14817523 GGGAGCACAGAGTATATGACTGG - Intronic
987750519 5:22032933-22032955 AGGAGAACAGACTGTAAGATGGG + Intronic
988053590 5:26062349-26062371 TGGACAACAGAGTTTAAGAAAGG - Intergenic
988953016 5:36284122-36284144 AGGAGAACAGGGTTTAAAATGGG - Intronic
992551345 5:77863237-77863259 GGGAGGAAAGAGTGTAAGAGAGG - Intronic
996627784 5:125590225-125590247 AGGAGAATAGAGTTTAAGAAAGG - Intergenic
997838092 5:137212908-137212930 GGGAGGTCAGAGGCTAAGCTTGG - Intronic
998918887 5:147045775-147045797 TGGAGCACAGAGACCAAGATGGG - Intronic
1000815234 5:165912934-165912956 GGGAAAACAGAGTCTCAAAGAGG - Intergenic
1000852653 5:166359370-166359392 GGGAGTGCAGAGTCTAGGCTGGG - Intergenic
1004443611 6:15676850-15676872 GGGAGAGTAGTTTCTAAGATTGG - Intergenic
1005381976 6:25244600-25244622 AAGAGAACAGAGTCCAAGGTTGG - Intergenic
1008657954 6:53634979-53635001 GTGACAACAGAGGCAAAGATTGG + Intergenic
1009031237 6:58060793-58060815 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1009207094 6:60815255-60815277 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1009384939 6:63076667-63076689 GAGAGAACTGAGTCTAAGCAGGG + Intergenic
1010055650 6:71560756-71560778 TGGAGAACAGAAACTCAGATTGG - Intergenic
1011135933 6:84100586-84100608 GGGAGAACAGGGTGTAAGACAGG - Intergenic
1011497501 6:87950999-87951021 GGGAGAAAAGTGTCTAACACAGG - Intergenic
1012101693 6:95096660-95096682 TTGAGAAAATAGTCTAAGATTGG - Intergenic
1013755879 6:113460949-113460971 GAGAGAACTGAGTCTCAGAAAGG + Intergenic
1014053758 6:116989012-116989034 GGGAGAACAGAGACCAGTATTGG - Intergenic
1016072781 6:139760678-139760700 GTGTGAACAGAAGCTAAGATGGG - Intergenic
1016130543 6:140463021-140463043 GGAAGCACAGAGTCTAATAAAGG + Intergenic
1018529768 6:164750421-164750443 GTGACAACAGAGACAAAGATTGG + Intergenic
1018735629 6:166685369-166685391 GGGAGGACAGAGGCTGAGAAGGG + Intronic
1019554795 7:1623904-1623926 GGGAGCACAGAGTCTGGGGTCGG - Intergenic
1021075089 7:16293405-16293427 CAGAGAATAGACTCTAAGATTGG - Intronic
1021363457 7:19746309-19746331 GGGAGTACAGAGGATAAGACTGG + Intronic
1022253159 7:28628867-28628889 GGGAGAAAAGATTATTAGATAGG + Intronic
1024914487 7:54484160-54484182 GGGAGAACAGAGTGTCTGAGTGG - Intergenic
1026546058 7:71323297-71323319 GGGAGAATACAGTATAAGCTGGG + Intronic
1026583476 7:71636880-71636902 TGGAGAACAGACTGTAAGCTGGG + Intronic
1026949559 7:74338363-74338385 AGGAGCACAGAGTCTAGGGTTGG - Intronic
1027542256 7:79481792-79481814 GGGATAACAGTGTGTAACATGGG - Intergenic
1027759952 7:82264914-82264936 GACAGAACAGAGTCTGAAATGGG - Intronic
1027782972 7:82542561-82542583 GGGAGAAATGAGTCTTATATAGG - Intergenic
1028233393 7:88331114-88331136 GGCAGAACTGAGCTTAAGATTGG + Intergenic
1028762669 7:94511856-94511878 GGGAGAATAGAATGTCAGATGGG + Intronic
1029432649 7:100541097-100541119 GGGAGAACAGAAGCAAAGAGAGG + Intronic
1031614480 7:123864764-123864786 GGGAAAACAGTGTCTGAGAGGGG + Intronic
1032328481 7:130954855-130954877 AAGAGAACAGAGTTTAAAATTGG + Intergenic
1033789619 7:144775825-144775847 TGGAGAATAGAGTATAAGAGAGG - Intronic
1036593694 8:10192949-10192971 GGGAGAACATAATATAATATGGG - Intronic
1037395824 8:18441638-18441660 GGGAGGACGGAGGCAAAGATGGG - Intergenic
1037600773 8:20391890-20391912 GGGAGAACAGGGTTTGAGAGGGG + Intergenic
1037653427 8:20861952-20861974 GGGAGAAGAGAGTTTAATAAAGG + Intergenic
1040792118 8:51243704-51243726 GGGAAAAAAGAGTTCAAGATGGG + Intergenic
1041996730 8:64070788-64070810 TGGAGACCAGAGTCTGAAATAGG + Intergenic
1042943244 8:74128434-74128456 GGGAAAACAGAGGCTTAGAGAGG + Intergenic
1043660784 8:82737594-82737616 AGGAAAACTGAGTCTAAGAATGG - Intergenic
1045651779 8:104348115-104348137 TGGAGGTCAGAGTCTAAAATGGG - Intronic
1046244948 8:111547194-111547216 GGGAGGAAAGAGTCTAAAACGGG - Intergenic
1047978961 8:130160011-130160033 GGCAGAATAGAATCAAAGATGGG - Intronic
1051094176 9:13446352-13446374 GGGAGAACTGAGTTTATGAAAGG - Intergenic
1051534251 9:18139434-18139456 GAGAGAACAGAGTCAAAGGAAGG + Intergenic
1052491588 9:29176422-29176444 GGGAGAACAAAGTCAAAGGAAGG - Intergenic
1053541975 9:38983149-38983171 GGGAGAACAGACTATATGCTGGG - Intergenic
1053806318 9:41805778-41805800 GGGAGAACAGACTATATGCTGGG - Intergenic
1054624165 9:67380761-67380783 GGGAGAACAGACTATATGCTGGG + Intergenic
1054762840 9:69018660-69018682 GAGAGAACAGAGTCAAGGAGGGG + Intergenic
1055495702 9:76852469-76852491 GGGAACACAGAGTCTCAGAGAGG - Intronic
1055704507 9:78982752-78982774 TGGAGGCCAGAGTCTAAAATGGG - Intergenic
1056081183 9:83095446-83095468 GGGGCAACACAGTCTAAGGTGGG - Intergenic
1056209019 9:84347778-84347800 GAAAGAGCAGAGACTAAGATGGG - Intergenic
1059935785 9:119309234-119309256 GGGAAAACTGAGTCTCAGAGCGG + Intronic
1060002068 9:119967853-119967875 GGGAGAACTGAGTCCCAGAAAGG + Intergenic
1060156096 9:121320876-121320898 GGGAAAACTGAGGCTAAGAGTGG + Intronic
1061175977 9:128997397-128997419 GGGAGGACAGAGTCTCAAAGAGG + Intronic
1061730463 9:132610103-132610125 GGGAGAGCAGATCCTAAGACAGG + Intronic
1187124026 X:16436602-16436624 GGGGGCACATAGTCTAAGCTTGG + Intergenic
1189655629 X:43241880-43241902 GGGAGAAGAGGGACTTAGATTGG - Intergenic
1190690595 X:52910061-52910083 GGAAGGACACAGACTAAGATGGG - Intergenic
1190695388 X:52945731-52945753 GGAAGGACACAGACTAAGATGGG + Intronic
1192410858 X:70930998-70931020 GGGAGCACAGAGTCTTGGACTGG + Exonic
1196759077 X:119183901-119183923 GGGAGATCAGTGTTTAACATTGG - Intergenic
1199574011 X:149295530-149295552 AAGAGAAGAGAATCTAAGATCGG - Intergenic