ID: 961916317

View in Genome Browser
Species Human (GRCh38)
Location 3:130378756-130378778
Sequence TCTCTGAGAGGATCACATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 4, 3: 15, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961916317_961916322 5 Left 961916317 3:130378756-130378778 CCCACATGTGATCCTCTCAGAGA 0: 1
1: 1
2: 4
3: 15
4: 145
Right 961916322 3:130378784-130378806 TCCCTGATTTCTTCATGTCTAGG 0: 1
1: 0
2: 1
3: 21
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961916317 Original CRISPR TCTCTGAGAGGATCACATGT GGG (reversed) Intronic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
903630025 1:24761394-24761416 TTTCTGAGAAAATGACATGTAGG + Intronic
903989461 1:27255968-27255990 TCTCTGAGAAGATGACATTTAGG - Intronic
909136672 1:71809865-71809887 TGTCTGTTAGGATCACAGGTTGG - Intronic
918876610 1:190054017-190054039 TAACTTTGAGGATCACATGTCGG - Intergenic
923361844 1:233219367-233219389 TCTGTGAGAGGATAAGATGCAGG + Intronic
923603856 1:235425797-235425819 TCTGGGAGAGGAGCACATGGCGG - Intronic
924630567 1:245736258-245736280 TCTATGAGAGAATCACATACTGG + Intergenic
1065615301 10:27515155-27515177 GCTGTGACAGGATCACATGGTGG + Intronic
1066694954 10:38069163-38069185 TCACAGAGAGGATAACCTGTGGG - Intergenic
1068219124 10:54021058-54021080 TCTCTGAGACCATAACCTGTAGG - Intronic
1068414925 10:56708235-56708257 ACTCTGAGAGGCTCAGAAGTAGG - Intergenic
1069254373 10:66313567-66313589 TCTCAGAGTGGATGACATTTAGG - Intronic
1070258142 10:74827454-74827476 TATCTGGGTGGATCGCATGTTGG + Intronic
1073117276 10:101098345-101098367 TCTCTGCAATGATCACATCTGGG + Intronic
1073874047 10:107900659-107900681 TCTGTGAGAAGACCACATGGGGG - Intergenic
1074139046 10:110655417-110655439 TCTCTGTGAGCATCAAATTTAGG - Intronic
1080504677 11:32900813-32900835 TTTCTGAGAAGGTAACATGTGGG - Intronic
1081134011 11:39415149-39415171 TCTCTGAGATGGTTAAATGTGGG - Intergenic
1081614271 11:44581244-44581266 GCTCTGGGAGGGTCAGATGTTGG + Intronic
1085298349 11:75443486-75443508 TCTCTGTGAGGGTCAGATGGGGG + Intronic
1091933051 12:4412664-4412686 TGCCTCAGAGGCTCACATGTGGG + Intergenic
1094064456 12:26348566-26348588 TCTCACAGAGGCTCAGATGTGGG + Intronic
1097446833 12:59681775-59681797 TCTTTGAGAGGGTCAGCTGTGGG + Intronic
1098937890 12:76501507-76501529 TCTCTGCTAAGATCACCTGTTGG - Intronic
1099638967 12:85259438-85259460 TCTCTGAGAGAATCACATATTGG - Intronic
1101125963 12:101633871-101633893 TCTCTGAGAAGATCACCTGGAGG + Intronic
1101414658 12:104498639-104498661 TCACTGAGAGTTTCACATCTGGG + Intronic
1102642206 12:114376988-114377010 TTTCTGAAAGGATCTCATCTTGG - Intronic
1103052376 12:117791276-117791298 TCTTTGAGAAGGTGACATGTAGG - Intronic
1104300076 12:127557026-127557048 TCTCTGAGAAGATGTTATGTGGG + Intergenic
1105593472 13:21815036-21815058 TCTGTGATGGGATCATATGTTGG - Intergenic
1107107342 13:36659076-36659098 TCTCTGAGAAGGTGACATTTTGG + Intergenic
1107977269 13:45702332-45702354 TCTCTCTGAGCATCACAGGTGGG - Exonic
1108066802 13:46586303-46586325 TCTCACAGAGGGCCACATGTGGG + Intronic
1108838256 13:54579015-54579037 CTTCTGAGAGGAACACATGAAGG - Intergenic
1112773665 13:102820656-102820678 TCTCTGAGAAGTTGACACGTGGG + Intronic
1113308743 13:109108753-109108775 TTTCTGGGAGGGTCACATGCAGG + Intronic
1115731961 14:36279796-36279818 ACTCTGAAAGGACCACCTGTTGG - Intergenic
1120072963 14:80123741-80123763 TATCTCAGAGGCTCACAGGTGGG + Intergenic
1121959160 14:98242553-98242575 TCTGTGAGAAGATTACCTGTAGG - Intergenic
1123125862 14:105945521-105945543 TCTCTGAGACACTCACATGGAGG + Intergenic
1126477264 15:49078841-49078863 TCACTGAAAGGACCACAGGTTGG - Intergenic
1127294360 15:57596728-57596750 TATCTGAGAAGACCACATATAGG - Intronic
1127837849 15:62805135-62805157 TCTCTGAGAGGATGTGAGGTTGG - Intronic
1129248568 15:74295429-74295451 CCTCTGAGCAGATCACATCTGGG + Intronic
1131028149 15:89162635-89162657 TCTCTGAGAGGGTGACATCTTGG - Intronic
1132957219 16:2600775-2600797 TCTCTGACAAGATCAGCTGTAGG + Exonic
1132969562 16:2679187-2679209 TCTCTGACAAGATCAGCTGTAGG + Intergenic
1135249819 16:20891569-20891591 TGTCAGAGAGGAGGACATGTAGG + Intronic
1135330670 16:21557260-21557282 CCTCTGAGACCATCACATATTGG + Intergenic
1135840035 16:25867818-25867840 GCACTGAGTGGATCTCATGTAGG + Intronic
1135972018 16:27079175-27079197 TCCATGAGGGGAACACATGTGGG - Intergenic
1139604862 16:68010858-68010880 TCTCTGAGATGATGACATTGTGG - Intronic
1139701101 16:68708513-68708535 TCTCTGACAGGCTGACATGTGGG - Intronic
1140128149 16:72134780-72134802 TCTCTGATAGGGTGACATTTGGG - Intronic
1142043694 16:87911727-87911749 CCTCTGAGACCATCACATATTGG + Intronic
1142408881 16:89906233-89906255 TCTCAGAGAGGATCACATGGCGG - Exonic
1144762523 17:17715422-17715444 TGGCTGAGAGGATTCCATGTGGG + Intronic
1152374153 17:79909940-79909962 ACTCTGATAATATCACATGTCGG - Intergenic
1153337281 18:3937597-3937619 TCTCAGAGAGGTGAACATGTTGG - Intronic
1155902086 18:31404447-31404469 GCTATGAGAGGATCTCATATGGG + Intronic
1157700290 18:49758002-49758024 TCTCTGTGAAGATGACATTTGGG + Intergenic
1158462122 18:57655642-57655664 TCTGGGAAAGGATCTCATGTGGG + Intronic
1160748659 19:723333-723355 TCTCTGGGAAGATAAGATGTTGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161266826 19:3367994-3368016 TCACTCAGGGGATCACAGGTAGG - Intronic
1164749600 19:30642801-30642823 TCTTTGAGTGGATCAAATATCGG + Intronic
1165017917 19:32897168-32897190 TCGCTAATAGGACCACATGTAGG + Intronic
927103315 2:19804550-19804572 ACAATGTGAGGATCACATGTGGG + Intergenic
927253243 2:21017453-21017475 TCTCTGATAAGGGCACATGTGGG + Intronic
928294154 2:30068347-30068369 TCTCTGAGTGAATGAAATGTTGG - Intergenic
929126325 2:38525374-38525396 TGTCTGAGAGGATATAATGTAGG - Intergenic
930111864 2:47685569-47685591 TGTCTGAGAGGGTCAGATGTGGG - Intergenic
931141403 2:59462366-59462388 TCTCTGACAGGAGCACATTTAGG - Intergenic
932322901 2:70834949-70834971 TCCCTGTGAAGATCACATCTAGG - Intronic
932458022 2:71862021-71862043 TGTCTGATAGGATCAGATGAAGG + Intergenic
934970089 2:98756202-98756224 ACTCTGAAAGGAGCAGATGTAGG + Intergenic
936902407 2:117496774-117496796 TCTTTAAGAGGATCACCTGGTGG + Intergenic
937904933 2:127048523-127048545 TCACTGAGAGGGTCCCATGACGG - Exonic
940882937 2:158965122-158965144 TCTCTCAGTGGATTACATATCGG + Intergenic
946478086 2:220028392-220028414 CCTCTGAGAGGATGACACTTAGG + Intergenic
947879214 2:233490559-233490581 TCTCTTAGAGGAGAAAATGTGGG - Intronic
1169592273 20:7158000-7158022 TCTCTGAGAGAACCCCATGAAGG + Intergenic
1170757467 20:19217072-19217094 TCCCTGAGAGCATGACATCTGGG + Intronic
1174062378 20:47841928-47841950 TCTCTGAGGAGGTGACATGTGGG - Intergenic
1174150819 20:48485069-48485091 TCTCTGAGGAGGTGACATGTGGG - Intergenic
1176947745 21:15004166-15004188 TGTTTGAGGGGATAACATGTTGG - Intronic
1180081695 21:45490255-45490277 TCCCTGAAAGGGTCACATGGAGG - Exonic
1182972514 22:34591079-34591101 TCTCTGAGAGGGTCAGAGGCCGG + Intergenic
949286362 3:2410504-2410526 CCTCTGAGAGGATAAAATGGAGG - Intronic
949468639 3:4370160-4370182 TCTCTGAGAAGATCACATGTGGG + Intronic
954484800 3:50837705-50837727 TTTCTGAGAAGATAACATTTGGG + Intronic
955269617 3:57484307-57484329 TCTCTTAGAATATCCCATGTAGG + Intronic
955766902 3:62354480-62354502 TCTTTGAAAGGATCATATTTAGG + Intergenic
960049028 3:113223188-113223210 TCCCTGAGAGGCTTACATGTGGG - Intronic
960600570 3:119453971-119453993 TCTCTGAGAGGATGGCATTTGGG + Intronic
960673071 3:120170514-120170536 TCTCTCTGAGGATCTCATGGGGG + Intronic
961916317 3:130378756-130378778 TCTCTGAGAGGATCACATGTGGG - Intronic
962003965 3:131329666-131329688 TCTCTGAGAAGATGACATGAGGG + Intronic
962080690 3:132136329-132136351 TCTCTGTGTGGATTAAATGTAGG + Intronic
962504986 3:136037641-136037663 TCTATGTGAGGATCACGTGAAGG + Intronic
962898916 3:139740090-139740112 TCTCTGTGAGGATGAAATGTGGG + Intergenic
966388486 3:179427169-179427191 CCACTGAGAAGATCACATTTGGG - Intronic
968477385 4:818380-818402 TCTCAGAGAGGCTGACATGGTGG + Intronic
973740920 4:53918794-53918816 GCTCTGAGAGGATCAGTGGTTGG - Intronic
977727946 4:100319565-100319587 TCTCTGAGCGGGTGACATTTAGG + Intergenic
978430065 4:108624285-108624307 TCTCTGATAGGATCACATGGGGG + Intronic
978606302 4:110483550-110483572 TCTCTGAGTGGATCAGATCAAGG - Intronic
978812318 4:112863997-112864019 TTTCTGAGAGGCTTACATTTGGG + Intronic
980240202 4:130163502-130163524 TCTCTCATAGGATCACTTATAGG + Intergenic
982642564 4:157981650-157981672 TCTCTGAGGAGATGACATTTAGG + Intergenic
983142076 4:164162593-164162615 TCCCTAAAAGGATGACATGTAGG - Intronic
983816214 4:172129879-172129901 TGTCTGAGGGGATCTCATTTTGG + Intronic
989106106 5:37864788-37864810 CCGCTGAGAGGCTCACCTGTTGG - Intergenic
990810141 5:59714149-59714171 TCTGTGAGTGGGTCACTTGTTGG - Intronic
990948941 5:61277406-61277428 TCTCTGAGAGGTTGAAATGGTGG - Intergenic
993769773 5:91912273-91912295 TCTTTGAAAGGTACACATGTAGG + Intergenic
993969247 5:94396950-94396972 TCTCTGAGGAGGTCACATTTGGG - Intronic
995744623 5:115390829-115390851 TGTCTCAGAGAATCACATTTTGG - Intergenic
997061750 5:130513499-130513521 TCTGGGAGAGGATCACAGTTTGG - Intergenic
998888542 5:146721116-146721138 TTTCTGAGAATATCACATGAAGG + Intronic
1003005731 6:2379744-2379766 TCTCTGCTTGAATCACATGTCGG - Intergenic
1005072264 6:21872723-21872745 TCTTTCAGAGGATCATATTTTGG + Intergenic
1010658134 6:78536808-78536830 TCTTTGAGAAGATAACATTTAGG + Intergenic
1011694001 6:89895648-89895670 TCTGTGAGAGGCTCACCTGAGGG - Exonic
1013422920 6:109982506-109982528 TCTCTGAGGAGATAACATCTAGG + Intergenic
1013491470 6:110650613-110650635 TCTTTGAGAAGATAACATTTGGG + Intronic
1013987537 6:116213661-116213683 TCTATGTGTAGATCACATGTAGG + Intronic
1014350111 6:120330923-120330945 TCTCTAAGAGGGTCACATTAGGG + Intergenic
1015054898 6:128888572-128888594 TCTTTGAGAGGATCTCACTTTGG + Intronic
1018025829 6:159804997-159805019 TCCCTCAGAAGATCACATGGGGG - Intronic
1018066419 6:160127688-160127710 TCTCTGTGTGGATGAGATGTTGG + Intronic
1018381550 6:163262366-163262388 TCACTGGGAGGATCACAGGCGGG + Intronic
1020962406 7:14821774-14821796 TCTCTGTGTGGAGGACATGTTGG + Intronic
1022262763 7:28722355-28722377 TCTCTGAGAGGGTCACCAGTCGG + Intronic
1025624141 7:63203471-63203493 TCTCTGAGTGGATCAGATCAAGG - Intergenic
1025923402 7:65936545-65936567 TCACTGAGAGGCGCACATGAGGG - Intronic
1027429838 7:78100175-78100197 ACTCTGAGAGGAGCACCAGTGGG - Intronic
1029821110 7:103148806-103148828 TCACTGATAGGAATACATGTGGG - Intronic
1031589871 7:123577606-123577628 TTTCTAAGAGGACCACATTTTGG - Intronic
1032754380 7:134874624-134874646 TCAGTGAGAGGAACTCATGTTGG - Intronic
1034088805 7:148345169-148345191 TCTCTGCGGGGTTCACATGGAGG + Intronic
1035029944 7:155850263-155850285 TCTCTGAGAGGATCCCTCCTCGG + Intergenic
1039100498 8:33936656-33936678 GGGCAGAGAGGATCACATGTGGG + Intergenic
1039305057 8:36252313-36252335 GCTCTGAGAAGATAAAATGTTGG + Intergenic
1041410117 8:57544334-57544356 TCTCTGAGAGGTCCCCAGGTGGG - Intergenic
1041896360 8:62929019-62929041 TCTCTGAGAAGAGGACATGTAGG + Intronic
1043365301 8:79526010-79526032 TCATTGATAGGATCACAAGTGGG - Intergenic
1046107051 8:109678853-109678875 CCTCTGACAGAATCACATGGTGG - Intronic
1048422912 8:134294846-134294868 TCTCTCAGAGGGTCCCCTGTGGG - Intergenic
1049324301 8:142014083-142014105 TCTCTCATAGGAACACATGTGGG + Intergenic
1055320599 9:75080274-75080296 ACTCTGAGAGAATCCCATGAAGG + Intronic
1056082336 9:83108537-83108559 TCTCTGAGAGAATCCAATGAAGG + Intergenic
1057865008 9:98673482-98673504 TCTCTGAGAGGAGTAGATGAAGG + Intronic
1185915487 X:4029822-4029844 TCTCTAAGAGCATTATATGTTGG - Intergenic
1187527364 X:20066260-20066282 TCTCTGGGAGCATCACAAGTTGG + Intronic
1189020690 X:37335143-37335165 TTTCTGAATGGATTACATGTAGG - Intergenic
1189129329 X:38481811-38481833 GCCATGAGAGGATCACATCTGGG - Intronic
1189565124 X:42233825-42233847 TCACTGAGAAGATAACATTTGGG + Intergenic
1193187846 X:78534919-78534941 TCTTTGTGATGATCACCTGTAGG + Intergenic
1193428377 X:81369108-81369130 GATCTGAGAGGACCACATTTTGG + Intergenic
1197236321 X:124069025-124069047 TCTCTGAGAGTATCAGATGTTGG + Intronic
1197314257 X:124945112-124945134 TCTCTGAGAAGGTCACATCTGGG + Intronic
1198777057 X:140191422-140191444 TCTTTGAGAGGATAACTTGGTGG - Intergenic
1201705738 Y:16934798-16934820 GCTCTGAGAGGATGACAGTTTGG + Intergenic