ID: 961916826

View in Genome Browser
Species Human (GRCh38)
Location 3:130384660-130384682
Sequence CTGTGCTTAATGAAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961916826 Original CRISPR CTGTGCTTAATGAAGTGTGC AGG Intronic
901726462 1:11246699-11246721 CTGTGCTTAGTGAAGCATTCAGG - Intronic
903417354 1:23193128-23193150 CTGTGTTTAATGAAGAGTTTCGG - Exonic
903906347 1:26690082-26690104 ATAGGCTTGATGAAGTGTGCTGG + Intergenic
907069885 1:51524801-51524823 CTGTCCTTTATGAAGAGTGCTGG + Intergenic
908368457 1:63453389-63453411 CTTTGCTTATTGAGGTGTGAAGG + Intronic
909488145 1:76197216-76197238 ATGTGCTAAATGAAGAGTGTTGG + Intronic
911228791 1:95337618-95337640 CTGTGATTGATGAGGTCTGCCGG + Intergenic
912205515 1:107504131-107504153 CCCTGCTTAATAAATTGTGCTGG + Intergenic
919486727 1:198156556-198156578 CTGTGTTTAATGTGGAGTGCAGG - Intergenic
920324059 1:205147702-205147724 CTGTGTTTGATGAGGAGTGCTGG - Exonic
921180484 1:212627961-212627983 CTTTGCATAAAGAAGTGGGCTGG - Intergenic
923283996 1:232473445-232473467 CTGTGTTTAATGGAGAGGGCTGG - Intronic
924586046 1:245362158-245362180 CTGTGCTTGATGGGGTGTGAAGG - Intronic
1063714738 10:8515486-8515508 CTGTGCTGAATGAATTAGGCAGG - Intergenic
1066178642 10:32938293-32938315 CTGTGATGAATGAAGCATGCAGG + Intronic
1066995600 10:42560134-42560156 CTGTGCTGGATGAAGTGAGGGGG + Intergenic
1069057367 10:63858521-63858543 CTGTGCTTAAAAAAATGTGTTGG + Intergenic
1069433841 10:68362026-68362048 CTGTACTTAAAAAAGTGGGCTGG + Intronic
1069898394 10:71693126-71693148 CTGTGATTGCTGAAGTCTGCTGG + Intronic
1070064472 10:73019789-73019811 TTTTGCTTAATCAAGTGTGCTGG - Intronic
1070655650 10:78269404-78269426 CAGCTGTTAATGAAGTGTGCAGG - Intergenic
1074707184 10:116143900-116143922 CTTTGCTAAAAGAGGTGTGCTGG + Intronic
1075172600 10:120129610-120129632 CTGTGCTTCATAAAATGTCCAGG - Intergenic
1075554053 10:123416786-123416808 CTGTGTTTAATGCAGTCTCCCGG + Intergenic
1078596671 11:12693014-12693036 CTGTGCTTAATGTCTTGTGTGGG + Intronic
1079508245 11:21179446-21179468 CTGTGCTTCATGATGTGAGTTGG + Intronic
1079624479 11:22599649-22599671 ATATGCCTAATGAAGTGTGGAGG + Intergenic
1082735769 11:56854073-56854095 CTGTGCTTAAAGAAGAGGGCAGG + Intergenic
1083065498 11:59919616-59919638 CTGTGGTTAATGGAGAGTCCAGG - Intergenic
1083893792 11:65610305-65610327 CTCAGCTTGATGAAGTGTTCAGG - Intronic
1085735729 11:79037292-79037314 CTGTGGTTTAAGAACTGTGCTGG - Intronic
1086504726 11:87493490-87493512 GTGTGCCTCATGAAGTGTTCTGG + Intergenic
1089557774 11:119324253-119324275 CTGTGCTGTCTGAAGTGTGGCGG + Intergenic
1089857081 11:121555336-121555358 CTGTTCTTAATTAAGGGAGCAGG + Intronic
1090040667 11:123288437-123288459 CTATGCTGAATGAAGTAAGCCGG - Intergenic
1091341419 11:134818340-134818362 CAATACTTAATGAAGTGTCCAGG - Intergenic
1095286164 12:40413214-40413236 CTCTGCTTCAAGCAGTGTGCAGG + Intronic
1106404615 13:29462935-29462957 CTGTGGTTAATGGACTTTGCAGG + Intronic
1110326477 13:74221956-74221978 CTTTGCTCAATGAACTCTGCTGG + Intergenic
1110834232 13:80065411-80065433 CTGTGCTTAACAAATTGTGATGG - Intergenic
1113280280 13:108780990-108781012 CTGTGCTTAAAGAAGTCATCAGG - Intronic
1118534866 14:66750555-66750577 CTGTGCTTAAAAAAGTGAGGGGG - Intronic
1118987963 14:70772910-70772932 CTGGGCTGAATGAAATGTCCTGG - Intronic
1121741297 14:96254131-96254153 CTGTGCTTGATGAAGTCCCCTGG - Intronic
1123193506 14:106593625-106593647 CTATGCCTAGTGAAGTCTGCAGG + Intergenic
1124578529 15:30930568-30930590 CTGTGCTCAGTGGTGTGTGCAGG + Exonic
1126796902 15:52266893-52266915 CTGTGCTGTGTGAAGTGGGCAGG - Intronic
1128072725 15:64807626-64807648 CTGTGCTTGGTAAACTGTGCAGG - Intergenic
1128773195 15:70298728-70298750 CTCTTCTTAAAGTAGTGTGCAGG + Intergenic
1137411938 16:48236001-48236023 CAGTGGTTAAGGAAGTGTCCAGG + Intronic
1138572846 16:57886697-57886719 CTGTCCTTTAGGAAGTCTGCTGG - Intronic
1138772285 16:59680259-59680281 TTGTGCTAAATTAAGTGTGGTGG - Intergenic
1139429963 16:66905720-66905742 CTGTGCTAAATGCATTGTGCAGG + Intergenic
1147968294 17:44206036-44206058 CTGGGCTTCAAGAAATGTGCTGG - Exonic
1151756591 17:76078842-76078864 CTGTGCTTAACGATGTGAGATGG - Intronic
1153590865 18:6673099-6673121 GGGTGATTAATGAAGTGGGCTGG - Intergenic
1155640818 18:28011940-28011962 CTGTGCTTACTGAATTGTCTTGG + Exonic
1160372542 18:78386445-78386467 CTTTAGTTAATGAAGTGTCCCGG + Intergenic
1163433259 19:17281128-17281150 CTGTGCTTAAAGGCGTGAGCTGG + Intronic
1164177052 19:22784290-22784312 CTGAGCTGAATGAAGAGTGACGG + Intergenic
1166965486 19:46527273-46527295 CTAAGGTTGATGAAGTGTGCCGG - Intronic
925792574 2:7507337-7507359 CTGTGCCTGAGGAATTGTGCAGG - Intergenic
926577170 2:14595101-14595123 CAGTGCTTAATCAAGTTTGGTGG + Intergenic
928051705 2:28003991-28004013 TTGTGCTTAATGAAGTCTTTAGG + Intronic
931485672 2:62688932-62688954 CTTTGCTTCATGAAGGGTCCTGG + Intronic
937012761 2:118576495-118576517 CTCTGTTTAAAGAAGTGTTCTGG - Intergenic
939643434 2:144668136-144668158 CTCTGCTTTATAAAGTTTGCAGG - Intergenic
941853360 2:170206339-170206361 CTGTGCCTAAGGAAGTGTGGTGG - Intronic
942370263 2:175276304-175276326 CTGTGCTTAATGAAATGGGCAGG - Intergenic
942673610 2:178403508-178403530 CTGTAGTTCATGAAGTCTGCAGG + Intergenic
945370963 2:209017162-209017184 CTGAGCATAATGAAGAGTGGCGG + Intergenic
948278269 2:236726735-236726757 CTGTGGTTCAAGAAGTGTGTCGG - Intergenic
1178761556 21:35407610-35407632 CTCTGCTTCAAGCAGTGTGCTGG + Intronic
1179001318 21:37462210-37462232 CTGTGCCTAGTGAATTGGGCTGG + Intronic
1179817406 21:43916391-43916413 TTCTGCTGAATGAAGTGTGTCGG + Intronic
1182903439 22:33918246-33918268 CTTCACTTAATGAAGTGTGCTGG - Intronic
953179657 3:40583845-40583867 CTGTGTTTAATCTAGTGTGAAGG - Intergenic
956941428 3:74166412-74166434 CTCTGCTTAATGCAGTCTTCAGG + Intergenic
957975330 3:87436096-87436118 CTTTGCTTTATGAAGCATGCTGG - Intergenic
960439601 3:117670498-117670520 CTGAGCCTGAAGAAGTGTGCAGG - Intergenic
960757862 3:121037067-121037089 CTGTGCATGATAATGTGTGCTGG - Intronic
961916826 3:130384660-130384682 CTGTGCTTAATGAAGTGTGCAGG + Intronic
965359457 3:167720053-167720075 CTGTGTTTAATGAGGTGAGTTGG - Exonic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
969851584 4:9961461-9961483 CTGTATTTAATAAATTGTGCTGG + Intronic
973146886 4:46838418-46838440 CTGTATTAGATGAAGTGTGCAGG + Intronic
973261700 4:48171690-48171712 CTGAGATTAATGAAGTATCCTGG - Intronic
975077438 4:70229302-70229324 TTCTGCTTAATAAAATGTGCTGG + Intronic
975459407 4:74632969-74632991 CTGGGCTTGATGAAGCCTGCTGG - Intergenic
975567930 4:75779560-75779582 CTTGGCTTAATGAAGTGTTGTGG - Intronic
978802813 4:112771506-112771528 CTGAGCTTGATGAGGTGTGGAGG + Intergenic
980167018 4:129241167-129241189 CTGTGCAGAATGAAGTTTGCAGG + Intergenic
980631353 4:135439094-135439116 CTTTGTTTTATGAAGTCTGCTGG - Intergenic
981212765 4:142128655-142128677 CTGAGCTTTGTGAAGTGTGTTGG + Intronic
983597643 4:169489109-169489131 CTGTGCATAAGGAAATGTTCAGG - Intronic
984343135 4:178484673-178484695 CTGTCATTAATGAAGTTTTCTGG - Intergenic
984730566 4:183064616-183064638 ATGTGGTTAATACAGTGTGCAGG - Intergenic
984953357 4:185022250-185022272 CTCTGCATAATGAAGTTTGATGG - Intergenic
988870520 5:35384739-35384761 CTGTGGGTACTGAAGTCTGCAGG + Intergenic
992352696 5:75947364-75947386 GTGTGCTGAATGAAGGCTGCAGG - Intergenic
993732192 5:91435663-91435685 CTATACCTAAGGAAGTGTGCAGG - Intergenic
995010977 5:107256958-107256980 GAGTGCTGAATGAAGTGGGCTGG - Intergenic
1006276462 6:33008450-33008472 CTGTGCCGACTGCAGTGTGCTGG - Intronic
1007005344 6:38357219-38357241 CTGTGATGAATGAAGTGGGTAGG - Intronic
1007041679 6:38727791-38727813 CAGTGCTGAATGAAGGGGGCAGG - Intronic
1013999647 6:116349724-116349746 CTGTCCTTACTGAAGTGAGGAGG + Intronic
1017308639 6:152950723-152950745 CTATGCATAATGAACTATGCTGG - Intergenic
1017424797 6:154309349-154309371 TTGTGCTTCAGGTAGTGTGCTGG - Intronic
1023364353 7:39448894-39448916 ATTTGCTTAATAAAGTGTGATGG - Intronic
1028869922 7:95758451-95758473 CTGTGCTGGATGTAGTGTTCAGG + Intergenic
1034673856 7:152877430-152877452 CTGTGCTGAAGACAGTGTGCAGG - Intergenic
1035656661 8:1313060-1313082 CTGTGCTGACTGGTGTGTGCCGG + Intergenic
1037681377 8:21100527-21100549 CTGTGCTGACAGCAGTGTGCTGG + Intergenic
1038788822 8:30648506-30648528 CTTTCCTTAATGAAGAGAGCTGG - Intronic
1041850982 8:62392544-62392566 CTTTGCATAATGAAGTGGCCAGG - Intronic
1045648797 8:104324273-104324295 CTGTGCACTATGAAGTGTTCAGG - Intergenic
1046321738 8:112587081-112587103 TTGTGCTAAATGAAATGTTCTGG + Exonic
1047044451 8:121036457-121036479 CATTGCTTAATGAAGGGAGCAGG + Intergenic
1048517791 8:135126199-135126221 CTGGGCTCAATGAAGTGTGTGGG - Intergenic
1049172416 8:141169859-141169881 CTGTGCTGTATGTAGTGTGTGGG + Intronic
1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG + Intergenic
1052703573 9:31967158-31967180 CTCTGTTTAATGAATGGTGCTGG + Intergenic
1056050107 9:82759139-82759161 CTGACCTTAATGAACAGTGCTGG - Intergenic
1058188964 9:101890111-101890133 CTCTGGTTAGTGAAGTTTGCAGG + Intergenic
1058973395 9:110103272-110103294 CTGTGCTTCAGGCACTGTGCTGG - Intronic
1059008839 9:110434182-110434204 CTTTGTTTAATGAACTGTGCTGG - Intronic
1062422953 9:136492795-136492817 CGGTGCTCAGTGAAGGGTGCCGG - Intergenic
1187664624 X:21591960-21591982 CATGGCTTAATGTAGTGTGCTGG + Intronic
1189997164 X:46650137-46650159 CTGGGCTTAATTTATTGTGCAGG - Intronic
1192310900 X:70013284-70013306 CTGTGGTTGCTGCAGTGTGCTGG - Intronic
1192863357 X:75103350-75103372 CTCTCCTTAATAAATTGTGCTGG - Intronic
1195682882 X:107561972-107561994 CTGTGCCTAATGCACTGTGTTGG - Intronic