ID: 961917268

View in Genome Browser
Species Human (GRCh38)
Location 3:130390324-130390346
Sequence AGGTTTTTACAGATACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961917262_961917268 28 Left 961917262 3:130390273-130390295 CCTAAGTATCAGGTCATGACTAG 0: 1
1: 0
2: 0
3: 0
4: 52
Right 961917268 3:130390324-130390346 AGGTTTTTACAGATACAGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 143
961917265_961917268 2 Left 961917265 3:130390299-130390321 CCAGTTCTCAGTGGGTCATTGAC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 961917268 3:130390324-130390346 AGGTTTTTACAGATACAGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961917268 Original CRISPR AGGTTTTTACAGATACAGCC TGG Intronic
904506355 1:30958488-30958510 AGTTTTTAAATGATACAGCCAGG + Intronic
905887718 1:41500630-41500652 AGGATTACTCAGATACAGCCTGG - Intergenic
906258218 1:44366892-44366914 AGGCTTTTACAGAGATATCCAGG + Intergenic
907788634 1:57638898-57638920 AGGGTTCTACAGATAAGGCCAGG + Intronic
910702123 1:90086811-90086833 AGTTTTTTAAGAATACAGCCAGG - Intergenic
911504712 1:98734216-98734238 TGGTATTTACAGATACAGAATGG - Intronic
912853374 1:113146253-113146275 ATGATTTTACACATACACCCTGG + Intergenic
924317997 1:242818398-242818420 AGGTTTTGATGGATACAGCAAGG - Intergenic
924561369 1:245158383-245158405 TTGTTTTTATAGAAACAGCCTGG + Intronic
1063679515 10:8173508-8173530 AGCTTTTTACAGAAACATTCAGG - Intergenic
1068310358 10:55266576-55266598 GGGTTTTTACAGGTACAGGATGG - Intronic
1071986272 10:91054008-91054030 AGGTTTTTATACATAAACCCTGG - Intergenic
1077734894 11:4781083-4781105 AGGAGTTTACAGCTCCAGCCAGG + Intronic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1081526029 11:43928411-43928433 AGGTTATTACTGATAAGGCCGGG + Intronic
1084852124 11:71950287-71950309 AGATTTTTATTGATATAGCCAGG + Intronic
1089147064 11:116336774-116336796 AGGCCTTTTCAAATACAGCCTGG - Intergenic
1090592390 11:128286355-128286377 AGGTTGTTACAGATGCGGGCAGG - Intergenic
1090711603 11:129391401-129391423 AGGTTGTGACAGACACAGCATGG + Intronic
1090815977 11:130296005-130296027 AGGTTTTTATACATAAACCCTGG - Intronic
1091129511 11:133133679-133133701 TGGTTTTTAAAGAAACAGCATGG - Intronic
1091165243 11:133469781-133469803 AGGTTTTTATAGATCCTACCTGG + Intronic
1094396590 12:30013461-30013483 AGGTTTTGAAAGGTACAGTCAGG + Intergenic
1094824523 12:34259207-34259229 AAATTTTTATAGCTACAGCCAGG - Intergenic
1095086694 12:38064128-38064150 AAATTTTTATAGCTACAGCCAGG + Intergenic
1095993107 12:48052116-48052138 AGCTTTTTTCAGCTTCAGCCTGG - Intronic
1098348141 12:69527490-69527512 AAATTTTTACATAAACAGCCTGG + Intronic
1098435414 12:70463709-70463731 ATGTTTATACTGAAACAGCCAGG + Intergenic
1099082496 12:78203253-78203275 AGGTTTTTAAAGAACCATCCAGG - Intronic
1101168949 12:102068051-102068073 AGTCATTTACAGACACAGCCAGG - Intergenic
1103027798 12:117587894-117587916 TGTTTTTTCCAGTTACAGCCTGG - Intronic
1109054647 13:57532171-57532193 AGGTTTTTACAGAGAAAGAGAGG + Intergenic
1113691614 13:112315087-112315109 CAGTTTTTAAAGATACAGCCAGG + Intergenic
1114742328 14:25110165-25110187 AGTCTTTTCCAGATACGGCCTGG - Intergenic
1117949150 14:61063531-61063553 ACATTTTTACTGATACACCCTGG - Intronic
1118069169 14:62226376-62226398 AAGTTTTTAAAGACACAGACTGG - Intergenic
1120296737 14:82651169-82651191 AGGAATTTACAGATAAAGCAAGG - Intergenic
1120317347 14:82912659-82912681 AAGATTTTACAGATATAGCTGGG + Intergenic
1120475017 14:84976015-84976037 ATGATATTACAGATACAGTCAGG + Intergenic
1120819855 14:88902045-88902067 AGATTTTTGGAGAGACAGCCTGG + Intergenic
1120953636 14:90062913-90062935 AGGCTTTTACAGATAGGGACAGG + Intronic
1122834186 14:104423138-104423160 AGGTTTCTGCAGGTCCAGCCGGG - Intergenic
1124657012 15:31516872-31516894 AGGTTTTTACTTATAGATCCTGG - Intronic
1125796852 15:42409685-42409707 GGGATTTTACAAACACAGCCAGG + Intronic
1126738850 15:51757853-51757875 TGCTTTTTAAAAATACAGCCTGG + Intronic
1127533955 15:59872521-59872543 AGGTTTTTATACATAAACCCTGG + Intergenic
1132847506 16:2007230-2007252 AGCATTTTACAGATAGGGCCAGG + Intronic
1134212151 16:12286731-12286753 AGGTACTAACAGCTACAGCCAGG - Intronic
1134599632 16:15523315-15523337 GGGTTTTTATAGATACAGGATGG + Intronic
1136132201 16:28230159-28230181 ACTTTTTTAAAGATACAGGCTGG - Intergenic
1137586592 16:49667532-49667554 AGGTATTTACAGCAACACCCTGG + Intronic
1137745712 16:50818693-50818715 AGCTTATTCCAGATACAGCAAGG + Intergenic
1138211307 16:55165391-55165413 AGGTTTTGACTGAGGCAGCCTGG - Intergenic
1138525858 16:57606939-57606961 AGGGTATCACAGAGACAGCCCGG - Intergenic
1141122286 16:81369331-81369353 TGGTTTTTGCAGATTCACCCAGG - Intronic
1141767283 16:86066992-86067014 AGGTTTTTATAGACACAGGAAGG + Intergenic
1142899808 17:3004807-3004829 AGGTGTTTAAAAATACAGACTGG - Intronic
1142934628 17:3318098-3318120 AGGTTCCCACAGAGACAGCCAGG + Intergenic
1148890288 17:50802224-50802246 AGGCTTTTATAGTTACAGGCAGG - Intergenic
1150127262 17:62645833-62645855 AGTTTTTTACAGGGAAAGCCAGG - Intronic
1153594155 18:6706894-6706916 AGGTCATTACAGGAACAGCCTGG - Intergenic
1153602587 18:6795887-6795909 AAGTTTTAAAACATACAGCCAGG + Intronic
1156743330 18:40359464-40359486 AGGTTTTTACAGGTCCAGGTAGG + Intergenic
1159734119 18:72073181-72073203 AGGGTTTTAAAGATACAGCACGG + Intergenic
933282616 2:80348569-80348591 ACGTTTTTCCAGAAACAGCATGG - Intronic
934518616 2:95005479-95005501 ACACATTTACAGATACAGCCAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936934151 2:117822153-117822175 AGGTTTTTATACATAAATCCTGG - Exonic
937535590 2:122882854-122882876 TTGGTTTTACGGATACAGCCTGG + Intergenic
940649916 2:156432182-156432204 AAGATTTTACAGATACTGGCCGG - Intergenic
941186235 2:162324578-162324600 AGGTTTTTATAGGTACAGGATGG + Intronic
942648024 2:178135827-178135849 AGGATTCTACAGAAACATCCTGG + Intronic
943579370 2:189666830-189666852 AGGTTTTTCAAGATACAGTTTGG - Exonic
946594034 2:221286033-221286055 AGTTTTTTTCAGATACGGCTTGG - Intergenic
946997750 2:225414658-225414680 AGGTGTTCACAGATACACCCAGG - Intronic
1169605706 20:7316501-7316523 TGCTTTTTTCAGATGCAGCCTGG + Intergenic
1169953406 20:11073807-11073829 AGGTGTTTAAAGAAACAGCCTGG + Intergenic
1170236697 20:14114291-14114313 AGGTATTTTAAGCTACAGCCAGG - Intronic
1170450982 20:16483401-16483423 AGTTTTATACAGATACAAGCTGG - Intronic
1173022944 20:39283211-39283233 AGGTTCTTACGTGTACAGCCAGG - Intergenic
1173150924 20:40565953-40565975 GGGTCTTGACAGATGCAGCCAGG + Intergenic
1173187990 20:40855998-40856020 AAGTCTTTACAGATAAAGCCTGG - Intergenic
1183800377 22:40158488-40158510 AGGTTTTTAAAGATAAAGACTGG - Intronic
1184846928 22:47093828-47093850 AGGTTGTTACAGAAACACCAGGG + Intronic
949495887 3:4631810-4631832 AGGTAATTACAGATACCCCCAGG + Intronic
952498319 3:33935643-33935665 AGGCTTTTACAGACTCTGCCTGG - Intergenic
954342539 3:49966966-49966988 ATTTTATTACAGATACAGCATGG - Intronic
954554178 3:51505426-51505448 AGATGTTGCCAGATACAGCCTGG + Intergenic
959653525 3:108774881-108774903 AGGCTTTTACAGATAAAAACTGG + Intergenic
961917268 3:130390324-130390346 AGGTTTTTACAGATACAGCCTGG + Intronic
966112117 3:176415819-176415841 AGCATTTTTCAGAAACAGCCTGG - Intergenic
967534271 3:190584887-190584909 AGGTTTTTTCAGACACAGTGGGG + Intronic
971947430 4:33299424-33299446 ATGTATTTACATATACAGCATGG - Intergenic
971965266 4:33546595-33546617 AGGTTTTTACAAGTACACTCTGG + Intergenic
974895399 4:67932031-67932053 AGATATTTATAGATTCAGCCTGG - Exonic
975825070 4:78310872-78310894 AGATTTCTACAGATACAGGCTGG - Intronic
980109775 4:128623953-128623975 AGATTTCTACAAATAAAGCCTGG + Intergenic
980490639 4:133522970-133522992 AGGTTTTTGCAGATACATTTGGG - Intergenic
983009110 4:162523034-162523056 AGAATTTTACAGATACATCAGGG - Intergenic
983898484 4:173106575-173106597 AGGTTTTTTCAGATACAGCTGGG - Intergenic
986422075 5:7595452-7595474 ATGTTTTTAAAAATAAAGCCAGG - Intronic
989470812 5:41815842-41815864 GGGTTTTTACAGCTACAGAAAGG + Intronic
989505246 5:42218997-42219019 AGGTTTTGGCAGATACAGGATGG + Intergenic
991647423 5:68815190-68815212 ACATCTTCACAGATACAGCCAGG - Intergenic
992852654 5:80826382-80826404 ATCTATTTACAGATACAGCTTGG - Intronic
993661168 5:90636644-90636666 TGTTTGTTCCAGATACAGCCTGG + Intronic
994345472 5:98680355-98680377 AGGTTTTTATACATAAACCCTGG - Intergenic
994531761 5:100981756-100981778 AGGTTTTTATGGATACAGAATGG - Intergenic
994818062 5:104610250-104610272 AGGTTGTTACAGAAAGAACCTGG + Intergenic
996615680 5:125438477-125438499 AGGTTCTTGCAGAAACAGGCAGG - Intergenic
997234794 5:132266544-132266566 AGGTATGTACAGACACTGCCTGG + Exonic
998565751 5:143214589-143214611 ATGTGTTTACAGATGCAGCCAGG - Intronic
998603853 5:143613840-143613862 AGGATTTTTCAGGTAAAGCCAGG - Intergenic
1004731547 6:18364450-18364472 AGGTTTTTATACATAAACCCTGG + Intergenic
1004992162 6:21150301-21150323 AGGTTTTCACAGAAATACCCAGG + Intronic
1006402039 6:33823292-33823314 AGGTGTTTACAGATACAATGGGG - Intergenic
1008740431 6:54600320-54600342 AGGTTTTTATATATTCACCCAGG + Intergenic
1009947364 6:70355419-70355441 AAGGTTTTACAGACACATCCTGG - Intergenic
1015085853 6:129291190-129291212 AGTTCTTTACAGATACATCAGGG - Intronic
1016487470 6:144557641-144557663 AGGTGTTTACAGATGCATCAGGG + Intronic
1018091873 6:160352648-160352670 CAGTTTTTATAGATTCAGCCAGG - Intronic
1018842993 6:167531953-167531975 GGGTTTTTACAGGCACAGGCTGG - Intergenic
1020944973 7:14592612-14592634 AGGTATGTACAGATACAGTTTGG - Intronic
1022045264 7:26617708-26617730 AGGTTGCTAAAGAAACAGCCAGG + Intergenic
1022312642 7:29211385-29211407 AGGTTTTAACAGATCCATTCTGG + Intronic
1022450054 7:30505602-30505624 AGGTTTTAAAAAATACACCCAGG - Intronic
1030156626 7:106461797-106461819 AGGGTTTGCCAGATACAGACAGG + Intergenic
1030216941 7:107053687-107053709 AGGTTTTAAAAGAAAAAGCCTGG - Intronic
1033889737 7:145996809-145996831 AGTTGGTTACAAATACAGCCAGG - Intergenic
1033992546 7:147306066-147306088 GGGTTCTTACAGATACAATCAGG - Intronic
1034140110 7:148807696-148807718 CTGTTGTTTCAGATACAGCCAGG - Exonic
1035744557 8:1952382-1952404 AGGTTTAGACAGATTCATCCAGG + Intronic
1043258818 8:78171400-78171422 AGGGCTTTACAGATACAGCACGG - Intergenic
1044616633 8:94149228-94149250 AGGTTTTAAAAGATACTTCCAGG - Intronic
1045978830 8:108160522-108160544 AATTTTTTAGAGATACAACCTGG - Intergenic
1047107788 8:121753418-121753440 AGCTTTTAACAGATACAGTGGGG - Intergenic
1047364945 8:124203169-124203191 GGGTGTTTACAGACAGAGCCAGG - Intergenic
1047741907 8:127813443-127813465 AGGCATTTACAAATACAACCAGG - Intergenic
1048637258 8:136310688-136310710 ATTTTTTTACAGAAAAAGCCAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055741332 9:79392905-79392927 AGTTTTTTAAAAATACAGGCTGG + Intergenic
1056459178 9:86792661-86792683 GGGTCTTTGCAGATACAGCTGGG + Intergenic
1058044964 9:100348616-100348638 AATTATTTCCAGATACAGCCAGG + Intronic
1058734637 9:107883197-107883219 AGTTGATTACAGAAACAGCCAGG + Intergenic
1060923138 9:127436753-127436775 ATGTTTCTAAAGATGCAGCCTGG + Intronic
1186032901 X:5389982-5390004 AGCTTTTTACAGATACACCTTGG - Intergenic
1188447970 X:30276658-30276680 AGGATTTTGCAGCTGCAGCCTGG - Intergenic
1192469489 X:71385259-71385281 AGGTTTTTAAAAATACACACTGG + Intronic
1194246874 X:91524949-91524971 AGGTTTTTAAAAATATGGCCGGG + Intergenic
1200565832 Y:4766219-4766241 AGGTTTTTAAAAATATGGCCGGG + Intergenic
1201221471 Y:11774908-11774930 AGGTTTTGATGGATACAGCAAGG - Intergenic