ID: 961919558

View in Genome Browser
Species Human (GRCh38)
Location 3:130411792-130411814
Sequence CCTCATGTCCTGTAATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961919558 Original CRISPR CCTCATGTCCTGTAATTGGC TGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902084739 1:13850409-13850431 CCTCCAGGCCTGTAATGGGCAGG - Intergenic
902682222 1:18051415-18051437 CCTGATGCCCTGTAAATGACAGG + Intergenic
904341924 1:29841043-29841065 CCTCCTGTCCTGTTATGGCCAGG - Intergenic
908746381 1:67380759-67380781 CCTCTTTTCCAGTAATTTGCAGG + Intronic
920985319 1:210883488-210883510 CTTCATGTCCTGTTATGGGATGG + Intronic
921785104 1:219220473-219220495 CATCATGCCCAGTAATTGTCAGG + Intergenic
921902240 1:220463234-220463256 CCCCAGGTCCTGTACTTGGGAGG - Intergenic
1063061812 10:2563410-2563432 CCTTAGGATCTGTAATTGGCTGG - Intergenic
1063993714 10:11595701-11595723 CATCATGTTCTGTAATTTGCAGG - Intronic
1065223868 10:23523292-23523314 CCTCGTGGCCTGTCCTTGGCAGG + Intergenic
1070256228 10:74814941-74814963 CCCCAACTCCTTTAATTGGCAGG + Intergenic
1079554357 11:21740543-21740565 CCTCTTGGCCTGTAATGGGAGGG + Intergenic
1081363969 11:42213100-42213122 CCTCAGGGCCTGTAATAGGAGGG - Intergenic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1085595385 11:77804303-77804325 CCTCAGGTTCTGTAATTCACCGG - Intronic
1087291689 11:96327347-96327369 CCTTAGTTTCTGTAATTGGCAGG + Intronic
1087873732 11:103330743-103330765 CCTCTTGTACTGAAACTGGCCGG + Intronic
1089386118 11:118069154-118069176 CCTCACAGCCTGTACTTGGCAGG - Intergenic
1090421984 11:126581738-126581760 CACCATGTCCTGTAATAGACAGG + Intronic
1091367038 11:135030954-135030976 CCTCATTTCCTGCATTTGGATGG + Intergenic
1091646659 12:2277283-2277305 ACTCATGTCCTGGAAATGTCTGG + Intronic
1095495144 12:42776487-42776509 CCTCATGTCCTGTGAACGTCCGG + Intergenic
1096113735 12:49043178-49043200 CCTCAGGTCCTGTAAATGCCAGG + Exonic
1097725917 12:63075929-63075951 CCTTATCTCCTGTAATTGCAGGG + Intergenic
1098703015 12:73653025-73653047 CCTCCAGTCCTGTAATGGGAGGG - Intergenic
1098705641 12:73685354-73685376 CCTCATGGCCTGCAATGGGTGGG + Intergenic
1099202373 12:79690992-79691014 CCTCCTGTCCTGGGATTGCCTGG - Exonic
1105742014 13:23336075-23336097 CATCATCTTCTGTAAATGGCTGG + Exonic
1109663096 13:65491600-65491622 CCTCATTTCTTGTTATTGTCAGG - Intergenic
1110059541 13:71024155-71024177 CCTATTGTCCTGTCATCGGCAGG - Intergenic
1111020110 13:82438190-82438212 CCTCAGGACCTGTAATGGGAGGG - Intergenic
1113342747 13:109442754-109442776 CCCCATTTCCTGTTTTTGGCAGG + Intergenic
1113718301 13:112530586-112530608 ACTCATGTCCTGCAGTCGGCCGG - Intronic
1116687090 14:48053448-48053470 CCCCCTGTCCTGTCATAGGCAGG + Intergenic
1117788052 14:59308226-59308248 CCTCATGTCCATTAATTGCAGGG - Intronic
1119850318 14:77862040-77862062 CCTCATGTCCTCTAATTCCCAGG + Intronic
1119933964 14:78573906-78573928 CCTCTAGTCCTGTAATGGGAGGG - Intronic
1120462427 14:84814464-84814486 CCTTAAGTCCTGTAATTTGCTGG - Intergenic
1124157200 15:27236414-27236436 CCTCCTGTCCTGTCATGGCCGGG - Intronic
1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG + Intergenic
1127362591 15:58257884-58257906 ACTAATGTCCTGTACATGGCAGG - Intronic
1132381929 15:101372095-101372117 CCTAATGGCCTGGAATTGGCAGG - Intronic
1132954720 16:2585562-2585584 CCTGAGGTCCTGTAAGTGCCGGG + Intronic
1134662733 16:15996583-15996605 CCTCCTGTCCTGGAGTTGGCTGG + Intronic
1141980960 16:87550409-87550431 CCCCATGCCCTGTGACTGGCAGG - Intergenic
1143331960 17:6144073-6144095 CCTCATGGTCTGAAGTTGGCTGG - Intergenic
1153564450 18:6405583-6405605 GCTCATTTCCTGTATTTAGCAGG - Intronic
1159103605 18:63981464-63981486 CATGATGTCCTGTAAGTGTCTGG + Intronic
1159140745 18:64390986-64391008 ACTGCTGTCCTGAAATTGGCAGG + Intergenic
1160126687 18:76180253-76180275 TCTCATCACCTGTAATTTGCAGG - Intergenic
925858760 2:8154996-8155018 CTTCTTGTCCTGCACTTGGCGGG + Intergenic
928825625 2:35417617-35417639 CCTCATGTACTGTCATTTACTGG - Intergenic
930882699 2:56290020-56290042 CCTCATTTCCTGCTATTGTCTGG + Intronic
931149029 2:59551994-59552016 CCTCAGGTCCTCTAATTTCCAGG + Intergenic
932142398 2:69291545-69291567 TCTCATCCCCTGAAATTGGCAGG - Intergenic
932819355 2:74886468-74886490 CCTGGTATCCTGTGATTGGCAGG + Exonic
937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG + Intergenic
939704966 2:145441481-145441503 CCTCATTTCTTGTTTTTGGCAGG - Intergenic
942264062 2:174203381-174203403 CCTGGTTTGCTGTAATTGGCAGG - Intronic
946043420 2:216802098-216802120 CCTCAAGTCTCCTAATTGGCAGG - Intergenic
947615643 2:231555228-231555250 CCTCCTGTCCTCTAACTGGGGGG - Intergenic
948277972 2:236724668-236724690 CCTCATGTCCTGGAATTTGGGGG + Intergenic
1170771615 20:19337836-19337858 TCTCATGTCTTGTGGTTGGCTGG + Intronic
1173323477 20:42010345-42010367 CCTCTGGTCCTGTGATTGGAGGG + Intergenic
1173599629 20:44284373-44284395 CCTCATTTGCCTTAATTGGCAGG - Intergenic
1178251617 21:31008797-31008819 CCACATGTCCTGGATGTGGCTGG - Intergenic
950397152 3:12742326-12742348 CCACATCTCCTGTATTTGGCTGG + Intronic
951484418 3:23195912-23195934 CATCATGTTCTGTCATTTGCTGG - Intergenic
953790672 3:45945592-45945614 CCTTAGCTCCTGTGATTGGCAGG - Exonic
956479045 3:69654319-69654341 CCTCTTGTGCTATAATTGCCAGG + Intergenic
959332405 3:105022947-105022969 CCTCTGGTCCTGTGATTGGAAGG - Intergenic
961919558 3:130411792-130411814 CCTCATGTCCTGTAATTGGCTGG - Intronic
970445919 4:16123302-16123324 CCTCATATCCAGTAAGAGGCAGG + Intergenic
976534624 4:86196824-86196846 CCTCATGGCTTGTTTTTGGCAGG + Intronic
977554202 4:98472172-98472194 CCTCATCTTCCGTAATTGGAGGG - Exonic
977955151 4:103018237-103018259 CCTTGTGTCTAGTAATTGGCAGG + Intronic
979639127 4:122991437-122991459 TCACATGTCTGGTAATTGGCAGG - Intronic
983634257 4:169881935-169881957 CCTCTGGTCCTGTAATGGGAGGG - Intergenic
985552738 5:541652-541674 CCTCAGGCCCTGTGATGGGCAGG - Intergenic
988316963 5:29643752-29643774 CCTCAGGGCCTGTGATTGGAGGG - Intergenic
991165359 5:63560975-63560997 CCCCATTTCCTGTATTTGTCAGG - Intergenic
994434661 5:99711601-99711623 CCTCCAGACCTGCAATTGGCAGG + Intergenic
999348911 5:150848279-150848301 CCTCATGTCCTGTGTTTCGAAGG - Exonic
1006182578 6:32163162-32163184 CCTCATGTCCTCTCATTTGGGGG + Exonic
1006828642 6:36955353-36955375 CCTCTTGTCCTCTCCTTGGCAGG - Intronic
1008283972 6:49627038-49627060 CCTCCTGGCCTGTAATGGGAGGG + Intronic
1008684831 6:53913941-53913963 CTTCATGTCCTGGATGTGGCAGG + Exonic
1009676612 6:66832088-66832110 GCTCAGCTGCTGTAATTGGCTGG - Intergenic
1011934833 6:92763365-92763387 CCTCATGTGCTGTAACTCTCTGG - Intergenic
1012074624 6:94669106-94669128 CCTCAGGGCCTGTAATGGGAGGG - Intergenic
1013171207 6:107637898-107637920 CCACATCTTCTGAAATTGGCTGG - Intronic
1018913785 6:168120538-168120560 CCTCTTGTTCTGTGATTGGCAGG + Intergenic
1022172158 7:27840926-27840948 TCTCCTGTCCTGGAAGTGGCCGG - Intronic
1023016501 7:35972877-35972899 CCTTATGTCCAATAATTGGGGGG - Intergenic
1023037843 7:36148585-36148607 TCTCATGTCCTGTGGGTGGCTGG + Intergenic
1028441889 7:90872508-90872530 TCTCATTTTCTGTAATTGGTAGG + Intronic
1031674186 7:124589014-124589036 CCTCTTGTCCTGTGATGGGATGG - Intergenic
1031934161 7:127718731-127718753 CTTCATGTTCTGTAATCAGCAGG + Intronic
1032513878 7:132492988-132493010 CTTCAGGTACTGTAATTAGCTGG - Intronic
1036705576 8:11043731-11043753 CCTCCTGTCCTGTCATGGGCGGG - Intronic
1045507501 8:102789029-102789051 GCTCATGTCCCTGAATTGGCAGG + Intergenic
1047537073 8:125729696-125729718 CCTCATGCCCTGGAATTGTCTGG - Intergenic
1051115259 9:13687088-13687110 CTTAATGTCATGTATTTGGCGGG - Intergenic
1051708154 9:19902198-19902220 CCTCCTGTCCTGTCATGGCCAGG + Intergenic
1052935374 9:34088626-34088648 CCTCATGTCAGGAGATTGGCTGG + Intronic
1053574463 9:39344900-39344922 CCTCTTGGCCTGTAATGGGAGGG - Intergenic
1053839026 9:42173148-42173170 CCTCTTGGCCTGTAATGGGAGGG - Intergenic
1054096027 9:60903590-60903612 CCTCTTGGCCTGTAATGGGAGGG - Intergenic
1054117490 9:61179529-61179551 CCTCTTGGCCTGTAATGGGAGGG - Intergenic
1054590265 9:67003037-67003059 CCTCTTGGCCTGTAATGGGAGGG + Intergenic
1060161963 9:121372139-121372161 CCTTCTGTCCTGTCATTGGCTGG + Intergenic
1061116376 9:128615693-128615715 CCTCTTGTCCTTTACTTGGGAGG - Exonic
1186106060 X:6207354-6207376 CCTTTTCTCCTATAATTGGCTGG + Intronic
1186992391 X:15084328-15084350 CCTCCTGGCCTGTAATGGGAGGG - Intergenic
1187288110 X:17925632-17925654 CCTCCTCTCCTGTAACTGTCAGG + Intergenic
1189565563 X:42237694-42237716 CCTAATGCCCTGTAGTAGGCAGG + Intergenic
1192587457 X:72330289-72330311 TCACATGTCCAGTAATTGGCTGG - Intronic
1194193306 X:90863188-90863210 CCTCATGTTTTATAATTGGCAGG - Intergenic
1194919803 X:99750921-99750943 CCTCTGGTCCTGTAATGGGAGGG - Intergenic
1196285156 X:113871393-113871415 CCTCCTGGCCTGTAATGGGAGGG - Intergenic
1196540432 X:116900684-116900706 CCTCCTGGCCTGTAATGGGAGGG + Intergenic
1200353690 X:155526148-155526170 CCTCAGGGCCTGTAATGGGATGG - Intronic
1200539922 Y:4445570-4445592 CCTCATGTTTTATAATTGGCAGG - Intergenic